Incidental Mutation 'R5036:Itsn1'
ID389549
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 91782235 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056482] [ENSMUST00000064797] [ENSMUST00000095909] [ENSMUST00000113993] [ENSMUST00000113996] [ENSMUST00000113999] [ENSMUST00000114001] [ENSMUST00000114002] [ENSMUST00000135057] [ENSMUST00000159295] [ENSMUST00000231535] [ENSMUST00000231974]
Predicted Effect probably benign
Transcript: ENSMUST00000056482
SMART Domains Protein: ENSMUSP00000056011
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064797
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095909
SMART Domains Protein: ENSMUSP00000093598
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113993
SMART Domains Protein: ENSMUSP00000109626
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1004 1064 2.46e-16 SMART
SH3 1085 1140 7.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113996
SMART Domains Protein: ENSMUSP00000109629
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 999 1059 2.46e-16 SMART
SH3 1080 1135 7.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113999
SMART Domains Protein: ENSMUSP00000109632
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114001
SMART Domains Protein: ENSMUSP00000109634
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 145 155 N/A INTRINSIC
EH 177 272 2.55e-49 SMART
EFh 221 249 1.77e-2 SMART
low complexity region 293 305 N/A INTRINSIC
coiled coil region 315 410 N/A INTRINSIC
coiled coil region 431 478 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
coiled coil region 524 624 N/A INTRINSIC
low complexity region 650 659 N/A INTRINSIC
SH3 704 761 1.05e-19 SMART
SH3 872 926 2.64e-16 SMART
SH3 961 1015 1.82e-19 SMART
SH3 1033 1093 2.46e-16 SMART
SH3 1114 1169 7.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114002
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133389
Predicted Effect probably benign
Transcript: ENSMUST00000135057
SMART Domains Protein: ENSMUSP00000117018
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 121 131 N/A INTRINSIC
EH 153 248 2.55e-49 SMART
EFh 197 225 1.77e-2 SMART
low complexity region 269 281 N/A INTRINSIC
coiled coil region 291 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139890
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231535
Predicted Effect probably benign
Transcript: ENSMUST00000231974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
Sector UTSW 16 91908487 critical splice donor site probably null
Weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91820796 intron probably benign
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4515:Itsn1 UTSW 16 91899649 missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91906789 nonsense probably null
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7720:Itsn1 UTSW 16 91868083 missense unknown
R7856:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7864:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7896:Itsn1 UTSW 16 91818558 missense unknown
R7897:Itsn1 UTSW 16 91818558 missense unknown
R7998:Itsn1 UTSW 16 91850936 missense unknown
R8075:Itsn1 UTSW 16 91889209 missense unknown
R8144:Itsn1 UTSW 16 91912005 missense unknown
R8160:Itsn1 UTSW 16 91818558 missense unknown
R8161:Itsn1 UTSW 16 91818558 missense unknown
R8215:Itsn1 UTSW 16 91812108 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTCTAGCTCAGGTGTTGGC -3'
(R):5'- CCCAAGCATCTCGTGAAATAAG -3'

Sequencing Primer
(F):5'- TTGGCGTTAAGATTAAAGACAGCAC -3'
(R):5'- CATCTCGTGAAATAAGATGAGGGTTG -3'
Posted On2016-06-06