Mutagenetix > Incidental Mutations

Incidental Mutation 'R5036:Scaf8'

389550

Institutional Source

Beutler Lab

Gene Symbol

Scaf8

Ensembl Gene

ENSMUSG00000046201

Gene Name

SR-related CTD-associated factor 8

Synonyms

Rbm16, A630086M08Rik, A930036P18Rik

MMRRC Submission

042627-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R5036 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3114972-3198859 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 3164262 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076734] [ENSMUST00000232048]

Predicted Effect

unknown
Transcript: ENSMUST00000076734
AA Change: S197R

SMART Domains

Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: S197R

Domain	Start	End	E-Value	Type
RPR	6	136	1.26e-42	SMART
low complexity region	157	171	N/A	INTRINSIC
low complexity region	193	223	N/A	INTRINSIC
low complexity region	232	251	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	397	462	N/A	INTRINSIC
RRM	478	547	9.2e-14	SMART
low complexity region	644	677	N/A	INTRINSIC
low complexity region	685	712	N/A	INTRINSIC
low complexity region	857	883	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
low complexity region	962	971	N/A	INTRINSIC
low complexity region	1027	1044	N/A	INTRINSIC
internal_repeat_1	1048	1064	2e-5	PROSPERO
internal_repeat_1	1059	1075	2e-5	PROSPERO
low complexity region	1146	1168	N/A	INTRINSIC
low complexity region	1249	1268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000232048

Meta Mutation Damage Score

0.0648

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (44/44)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	G	A	7: 41,626,154	G427D	possibly damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
C4b	T	A	17: 34,740,445		probably null	Het
Cabyr	A	T	18: 12,751,246	E263D	probably damaging	Het
Car1	A	T	3: 14,776,239	D45E	possibly damaging	Het
Col25a1	T	C	3: 130,583,329		probably null	Het
Dnah6	G	T	6: 73,044,691	S3549R	probably benign	Het
Dync1h1	A	T	12: 110,630,535	I1639F	probably damaging	Het
Fhad1	A	T	4: 141,920,741	D271E	probably benign	Het
Gle1	T	C	2: 29,936,211	S101P	probably benign	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,150	Y232C	probably damaging	Het
Gtf2ird2	A	G	5: 134,217,507	N869S	probably damaging	Het
Ifi204	G	A	1: 173,752,745	P400S	possibly damaging	Het
Ighv2-2	T	C	12: 113,588,472	T49A	possibly damaging	Het
Itsn1	T	A	16: 91,782,235		probably benign	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Nf1	C	A	11: 79,446,864	Q1098K	probably damaging	Het
Odc1	C	A	12: 17,548,019	Q116K	probably damaging	Het
Otof	C	T	5: 30,384,439	E761K	possibly damaging	Het
Palld	A	T	8: 61,550,162	V301D	probably damaging	Het
Pask	A	T	1: 93,322,079	L533*	probably null	Het
Plekhh2	T	C	17: 84,571,761	S638P	probably damaging	Het
Sdccag8	G	T	1: 177,011,975	R695L	probably damaging	Het
Serpina1c	A	G	12: 103,898,826	I187T	probably damaging	Het
Slitrk5	G	T	14: 111,680,884	G647W	possibly damaging	Het
Sycp1	T	A	3: 102,820,600	K899M	probably damaging	Het
Taok1	G	A	11: 77,549,331	R617C	probably benign	Het
Tbc1d32	A	C	10: 56,195,404	Y341*	probably null	Het
Tenm4	A	G	7: 96,694,790	N267D	probably damaging	Het
Tenm4	T	C	7: 96,852,561	V1287A	probably damaging	Het
Tsga10	A	T	1: 37,783,968	V488E	possibly damaging	Het
Ttc39c	G	T	18: 12,687,081		probably null	Het
Uck1	A	T	2: 32,258,466		probably benign	Het
Vmn2r98	A	G	17: 19,066,157	I306V	probably benign	Het

Other mutations in Scaf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Scaf8	APN	17	3171134	missense	unknown
IGL00956:Scaf8	APN	17	3171147	missense	unknown
IGL01610:Scaf8	APN	17	3195849	missense	probably damaging	1.00
IGL01967:Scaf8	APN	17	3196938	missense	possibly damaging	0.91
IGL02005:Scaf8	APN	17	3185870	missense	probably damaging	1.00
IGL03037:Scaf8	APN	17	3190221	missense	probably damaging	0.99
BB004:Scaf8	UTSW	17	3159220	missense	unknown
BB014:Scaf8	UTSW	17	3159220	missense	unknown
R0320:Scaf8	UTSW	17	3178255	missense	unknown
R0789:Scaf8	UTSW	17	3196837	missense	possibly damaging	0.94
R0850:Scaf8	UTSW	17	3195774	splice site	probably null
R0919:Scaf8	UTSW	17	3197120	missense	probably damaging	1.00
R1488:Scaf8	UTSW	17	3197597	missense	probably damaging	0.97
R1544:Scaf8	UTSW	17	3145154	missense	probably damaging	0.96
R1928:Scaf8	UTSW	17	3168077	missense	unknown
R1972:Scaf8	UTSW	17	3169371	missense	unknown
R2156:Scaf8	UTSW	17	3164132	splice site	probably null
R2164:Scaf8	UTSW	17	3197210	missense	probably damaging	1.00
R2680:Scaf8	UTSW	17	3197591	missense	possibly damaging	0.95
R3794:Scaf8	UTSW	17	3190249	missense	probably damaging	1.00
R4368:Scaf8	UTSW	17	3171195	missense	unknown
R4673:Scaf8	UTSW	17	3197985	missense	probably benign	0.04
R4694:Scaf8	UTSW	17	3197404	missense	probably damaging	1.00
R4716:Scaf8	UTSW	17	3177123	missense	unknown
R4852:Scaf8	UTSW	17	3178219	missense	unknown
R5193:Scaf8	UTSW	17	3190165	missense	probably benign	0.02
R5429:Scaf8	UTSW	17	3197110	missense	probably benign	0.14
R5816:Scaf8	UTSW	17	3177713	missense	unknown
R6050:Scaf8	UTSW	17	3168108	missense	unknown
R6493:Scaf8	UTSW	17	3171119	missense	unknown
R6616:Scaf8	UTSW	17	3168055	missense	unknown
R7065:Scaf8	UTSW	17	3159211	missense	probably damaging	1.00
R7112:Scaf8	UTSW	17	3163029	missense	unknown
R7141:Scaf8	UTSW	17	3159182	missense	unknown
R7198:Scaf8	UTSW	17	3163098	missense	unknown
R7265:Scaf8	UTSW	17	3177625	missense	unknown
R7592:Scaf8	UTSW	17	3171222	critical splice donor site	probably null
R7711:Scaf8	UTSW	17	3187634	missense	probably damaging	0.97
R7813:Scaf8	UTSW	17	3197274	missense	probably damaging	1.00
R7867:Scaf8	UTSW	17	3177719	missense	unknown
R7927:Scaf8	UTSW	17	3159220	missense	unknown
R7937:Scaf8	UTSW	17	3197207	missense	probably damaging	0.99
R7958:Scaf8	UTSW	17	3171122	missense	unknown
R7960:Scaf8	UTSW	17	3171122	missense	unknown
R8024:Scaf8	UTSW	17	3159293	missense	unknown
R8118:Scaf8	UTSW	17	3164183	missense	unknown
R8285:Scaf8	UTSW	17	3177129	missense	unknown
R8303:Scaf8	UTSW	17	3148552	missense	unknown
R8365:Scaf8	UTSW	17	3195966	missense	possibly damaging	0.67
R8544:Scaf8	UTSW	17	3163020	unclassified	probably benign
Z1088:Scaf8	UTSW	17	3162983	unclassified	probably benign
Z1177:Scaf8	UTSW	17	3162994	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCGTTTTCAAGATGGAGGCAG -3'
(R):5'- ATGTGCTACCTCAGTGATCTG -3'

Sequencing Primer
(F):5'- CAGTAAAGTGAAAGCATACTATCTGC -3'
(R):5'- CACACCATAAAGGGGGTA -3'

Posted On

2016-06-06