Incidental Mutation 'R5036:Scaf8'
ID389550
Institutional Source Beutler Lab
Gene Symbol Scaf8
Ensembl Gene ENSMUSG00000046201
Gene NameSR-related CTD-associated factor 8
SynonymsRbm16, A630086M08Rik, A930036P18Rik
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3114972-3198859 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 3164262 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076734] [ENSMUST00000232048]
Predicted Effect unknown
Transcript: ENSMUST00000076734
AA Change: S197R
SMART Domains Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: S197R

DomainStartEndE-ValueType
RPR 6 136 1.26e-42 SMART
low complexity region 157 171 N/A INTRINSIC
low complexity region 193 223 N/A INTRINSIC
low complexity region 232 251 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 397 462 N/A INTRINSIC
RRM 478 547 9.2e-14 SMART
low complexity region 644 677 N/A INTRINSIC
low complexity region 685 712 N/A INTRINSIC
low complexity region 857 883 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
low complexity region 962 971 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
internal_repeat_1 1048 1064 2e-5 PROSPERO
internal_repeat_1 1059 1075 2e-5 PROSPERO
low complexity region 1146 1168 N/A INTRINSIC
low complexity region 1249 1268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232048
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Scaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Scaf8 APN 17 3171134 missense unknown
IGL00956:Scaf8 APN 17 3171147 missense unknown
IGL01610:Scaf8 APN 17 3195849 missense probably damaging 1.00
IGL01967:Scaf8 APN 17 3196938 missense possibly damaging 0.91
IGL02005:Scaf8 APN 17 3185870 missense probably damaging 1.00
IGL03037:Scaf8 APN 17 3190221 missense probably damaging 0.99
R0320:Scaf8 UTSW 17 3178255 missense unknown
R0789:Scaf8 UTSW 17 3196837 missense possibly damaging 0.94
R0850:Scaf8 UTSW 17 3195774 splice site probably null
R0919:Scaf8 UTSW 17 3197120 missense probably damaging 1.00
R1488:Scaf8 UTSW 17 3197597 missense probably damaging 0.97
R1544:Scaf8 UTSW 17 3145154 missense probably damaging 0.96
R1928:Scaf8 UTSW 17 3168077 missense unknown
R1972:Scaf8 UTSW 17 3169371 missense unknown
R2156:Scaf8 UTSW 17 3164132 splice site probably null
R2164:Scaf8 UTSW 17 3197210 missense probably damaging 1.00
R2680:Scaf8 UTSW 17 3197591 missense possibly damaging 0.95
R3794:Scaf8 UTSW 17 3190249 missense probably damaging 1.00
R4368:Scaf8 UTSW 17 3171195 missense unknown
R4673:Scaf8 UTSW 17 3197985 missense probably benign 0.04
R4694:Scaf8 UTSW 17 3197404 missense probably damaging 1.00
R4716:Scaf8 UTSW 17 3177123 missense unknown
R4852:Scaf8 UTSW 17 3178219 missense unknown
R5193:Scaf8 UTSW 17 3190165 missense probably benign 0.02
R5429:Scaf8 UTSW 17 3197110 missense probably benign 0.14
R5816:Scaf8 UTSW 17 3177713 missense unknown
R6050:Scaf8 UTSW 17 3168108 missense unknown
R6493:Scaf8 UTSW 17 3171119 missense unknown
R6616:Scaf8 UTSW 17 3168055 missense unknown
R7065:Scaf8 UTSW 17 3159211 missense probably damaging 1.00
R7112:Scaf8 UTSW 17 3163029 missense unknown
R7141:Scaf8 UTSW 17 3159182 missense unknown
R7198:Scaf8 UTSW 17 3163098 missense unknown
R7265:Scaf8 UTSW 17 3177625 missense unknown
R7592:Scaf8 UTSW 17 3171222 critical splice donor site probably null
R7711:Scaf8 UTSW 17 3187634 missense probably damaging 0.97
R7813:Scaf8 UTSW 17 3197274 missense probably damaging 1.00
Z1088:Scaf8 UTSW 17 3162983 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGTTTTCAAGATGGAGGCAG -3'
(R):5'- ATGTGCTACCTCAGTGATCTG -3'

Sequencing Primer
(F):5'- CAGTAAAGTGAAAGCATACTATCTGC -3'
(R):5'- CACACCATAAAGGGGGTA -3'
Posted On2016-06-06