Mutagenetix > Incidental Mutations

Incidental Mutation 'R5036:Vmn2r98'

389551

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

042627-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R5036 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19066157 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 306 (I306V)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

Predicted Effect

probably benign
Transcript: ENSMUST00000170424
AA Change: I306V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: I306V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (44/44)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	G	A	7: 41,626,154	G427D	possibly damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
C4b	T	A	17: 34,740,445		probably null	Het
Cabyr	A	T	18: 12,751,246	E263D	probably damaging	Het
Car1	A	T	3: 14,776,239	D45E	possibly damaging	Het
Col25a1	T	C	3: 130,583,329		probably null	Het
Dnah6	G	T	6: 73,044,691	S3549R	probably benign	Het
Dync1h1	A	T	12: 110,630,535	I1639F	probably damaging	Het
Fhad1	A	T	4: 141,920,741	D271E	probably benign	Het
Gle1	T	C	2: 29,936,211	S101P	probably benign	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,150	Y232C	probably damaging	Het
Gtf2ird2	A	G	5: 134,217,507	N869S	probably damaging	Het
Ifi204	G	A	1: 173,752,745	P400S	possibly damaging	Het
Ighv2-2	T	C	12: 113,588,472	T49A	possibly damaging	Het
Itsn1	T	A	16: 91,782,235		probably benign	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Nf1	C	A	11: 79,446,864	Q1098K	probably damaging	Het
Odc1	C	A	12: 17,548,019	Q116K	probably damaging	Het
Otof	C	T	5: 30,384,439	E761K	possibly damaging	Het
Palld	A	T	8: 61,550,162	V301D	probably damaging	Het
Pask	A	T	1: 93,322,079	L533*	probably null	Het
Plekhh2	T	C	17: 84,571,761	S638P	probably damaging	Het
Scaf8	T	A	17: 3,164,262		probably benign	Het
Sdccag8	G	T	1: 177,011,975	R695L	probably damaging	Het
Serpina1c	A	G	12: 103,898,826	I187T	probably damaging	Het
Slitrk5	G	T	14: 111,680,884	G647W	possibly damaging	Het
Sycp1	T	A	3: 102,820,600	K899M	probably damaging	Het
Taok1	G	A	11: 77,549,331	R617C	probably benign	Het
Tbc1d32	A	C	10: 56,195,404	Y341*	probably null	Het
Tenm4	A	G	7: 96,694,790	N267D	probably damaging	Het
Tenm4	T	C	7: 96,852,561	V1287A	probably damaging	Het
Tsga10	A	T	1: 37,783,968	V488E	possibly damaging	Het
Ttc39c	G	T	18: 12,687,081		probably null	Het
Uck1	A	T	2: 32,258,466		probably benign	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAGAGAAATGGCATCTGC -3'
(R):5'- GTTTCCCAACACATGACAATTAGTG -3'

Sequencing Primer
(F):5'- CTGCCTAGCTTTTGTAAAAATGACC -3'
(R):5'- TAGTGTCAGAAAATGAGCACTTG -3'

Posted On

2016-06-06