Mutagenetix > Incidental Mutations

Incidental Mutation 'R5036:Plekhh2'

389553

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

042627-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R5036 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84571761 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 638 (S638P)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047206
AA Change: S638P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: S638P

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Meta Mutation Damage Score

0.0798

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (44/44)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	G	A	7: 41,626,154	G427D	possibly damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
C4b	T	A	17: 34,740,445		probably null	Het
Cabyr	A	T	18: 12,751,246	E263D	probably damaging	Het
Car1	A	T	3: 14,776,239	D45E	possibly damaging	Het
Col25a1	T	C	3: 130,583,329		probably null	Het
Dnah6	G	T	6: 73,044,691	S3549R	probably benign	Het
Dync1h1	A	T	12: 110,630,535	I1639F	probably damaging	Het
Fhad1	A	T	4: 141,920,741	D271E	probably benign	Het
Gle1	T	C	2: 29,936,211	S101P	probably benign	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,150	Y232C	probably damaging	Het
Gtf2ird2	A	G	5: 134,217,507	N869S	probably damaging	Het
Ifi204	G	A	1: 173,752,745	P400S	possibly damaging	Het
Ighv2-2	T	C	12: 113,588,472	T49A	possibly damaging	Het
Itsn1	T	A	16: 91,782,235		probably benign	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Nf1	C	A	11: 79,446,864	Q1098K	probably damaging	Het
Odc1	C	A	12: 17,548,019	Q116K	probably damaging	Het
Otof	C	T	5: 30,384,439	E761K	possibly damaging	Het
Palld	A	T	8: 61,550,162	V301D	probably damaging	Het
Pask	A	T	1: 93,322,079	L533*	probably null	Het
Scaf8	T	A	17: 3,164,262		probably benign	Het
Sdccag8	G	T	1: 177,011,975	R695L	probably damaging	Het
Serpina1c	A	G	12: 103,898,826	I187T	probably damaging	Het
Slitrk5	G	T	14: 111,680,884	G647W	possibly damaging	Het
Sycp1	T	A	3: 102,820,600	K899M	probably damaging	Het
Taok1	G	A	11: 77,549,331	R617C	probably benign	Het
Tbc1d32	A	C	10: 56,195,404	Y341*	probably null	Het
Tenm4	A	G	7: 96,694,790	N267D	probably damaging	Het
Tenm4	T	C	7: 96,852,561	V1287A	probably damaging	Het
Tsga10	A	T	1: 37,783,968	V488E	possibly damaging	Het
Ttc39c	G	T	18: 12,687,081		probably null	Het
Uck1	A	T	2: 32,258,466		probably benign	Het
Vmn2r98	A	G	17: 19,066,157	I306V	probably benign	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTCTGTAAAGCATTGCCTGTG -3'
(R):5'- CTAGGCTCATGTCCATTACGG -3'

Sequencing Primer
(F):5'- CTGTAAAGCATTGCCTGTGTAAAGAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'

Posted On

2016-06-06