Incidental Mutation 'R5036:Ttc39c'
ID389554
Institutional Source Beutler Lab
Gene Symbol Ttc39c
Ensembl Gene ENSMUSG00000024424
Gene Nametetratricopeptide repeat domain 39C
Synonyms
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12599926-12737050 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 12687081 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025294] [ENSMUST00000169401]
Predicted Effect probably null
Transcript: ENSMUST00000025294
SMART Domains Protein: ENSMUSP00000025294
Gene: ENSMUSG00000024424

DomainStartEndE-ValueType
Pfam:DUF3808 31 495 7.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141060
Predicted Effect probably null
Transcript: ENSMUST00000169401
SMART Domains Protein: ENSMUSP00000133127
Gene: ENSMUSG00000024424

DomainStartEndE-ValueType
Pfam:DUF3808 1 437 1.6e-134 PFAM
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Ttc39c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Ttc39c APN 18 12684895 splice site probably benign
IGL02323:Ttc39c APN 18 12736743 missense probably null 0.79
R1628:Ttc39c UTSW 18 12734879 splice site probably benign
R1771:Ttc39c UTSW 18 12684824 splice site probably null
R2002:Ttc39c UTSW 18 12697878 splice site probably null
R4162:Ttc39c UTSW 18 12724937 critical splice acceptor site probably null
R4344:Ttc39c UTSW 18 12728610 splice site probably null
R4484:Ttc39c UTSW 18 12730069 missense possibly damaging 0.90
R4752:Ttc39c UTSW 18 12728725 missense probably benign 0.05
R4872:Ttc39c UTSW 18 12687116 intron probably benign
R4912:Ttc39c UTSW 18 12734894 missense probably benign 0.00
R4946:Ttc39c UTSW 18 12724942 nonsense probably null
R5439:Ttc39c UTSW 18 12695371 missense possibly damaging 0.88
R5726:Ttc39c UTSW 18 12697935 missense probably damaging 1.00
R7213:Ttc39c UTSW 18 12687081 critical splice donor site probably null
R7400:Ttc39c UTSW 18 12643799 intron probably benign
R7413:Ttc39c UTSW 18 12728689 missense possibly damaging 0.65
R7567:Ttc39c UTSW 18 12689879 missense probably benign 0.01
Z1088:Ttc39c UTSW 18 12686963 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTGTAACAGTGCGTGAACC -3'
(R):5'- ATGGCTATCATGACTGAAGGG -3'

Sequencing Primer
(F):5'- GCGTGAACCTTTTTACCTGAGAATC -3'
(R):5'- AGGGGCTTCTTCTACTCTAAGAGAC -3'
Posted On2016-06-06