Mutagenetix > Incidental Mutation

Incidental Mutation 'R5037:Raph1'

389556

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R5037 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 60496222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably null
Transcript: ENSMUST00000027168

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000027168

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090293

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090293

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000140485

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000140485

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000182085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188511

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,972,195	H509Q	probably benign	Het
6430531B16Rik	A	T	7: 139,978,674	S3R	possibly damaging	Het
Btaf1	T	C	19: 37,003,531	V1584A	probably damaging	Het
Ccdc136	A	T	6: 29,417,123	S648C	probably damaging	Het
Ccna2	A	G	3: 36,571,003		probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cenpf	T	C	1: 189,683,846	E94G	probably damaging	Het
Clic1	G	A	17: 35,055,259	V139I	probably benign	Het
Coasy	A	G	11: 101,084,822	E327G	probably damaging	Het
Col6a5	C	T	9: 105,928,138	E1190K	unknown	Het
Cyp2c70	A	G	19: 40,183,997	V67A	possibly damaging	Het
Dglucy	A	G	12: 100,835,241	S52G	probably benign	Het
Dync1h1	A	G	12: 110,640,907	N2644S	probably benign	Het
Eif4g2	A	T	7: 111,077,032	N347K	probably benign	Het
Epha10	T	C	4: 124,915,385		probably benign	Het
Epm2aip1	T	C	9: 111,272,150	F64L	probably benign	Het
Eri2	G	A	7: 119,785,674	L535F	probably benign	Het
Fam71e2	T	G	7: 4,758,576	K379T	possibly damaging	Het
Gm17430	T	C	18: 9,726,561	E37G	probably benign	Het
Heatr5b	T	A	17: 78,824,510	Q388L	probably benign	Het
Htr1f	A	G	16: 64,925,928	W334R	probably damaging	Het
Icam4	A	T	9: 21,029,641	C717*	probably null	Het
Iqgap1	A	C	7: 80,734,100	L1072W	probably damaging	Het
Kbtbd11	G	T	8: 15,027,886	A162S	probably benign	Het
Kif13b	T	G	14: 64,758,589	Y941*	probably null	Het
Kndc1	T	C	7: 139,910,455	V291A	possibly damaging	Het
Lrrn3	A	T	12: 41,453,595	I241N	probably damaging	Het
Macf1	A	G	4: 123,455,519	S2387P	probably damaging	Het
Msh5	A	G	17: 35,032,393	L451S	possibly damaging	Het
Mthfd1	T	G	12: 76,294,140	F258V	probably damaging	Het
Ncstn	C	T	1: 172,068,626	R495H	probably damaging	Het
Olfr730	T	G	14: 50,186,288	T310P	probably benign	Het
Pkd1l3	T	A	8: 109,665,636	I1954N	probably damaging	Het
Ppox	C	A	1: 171,277,596	V340L	probably damaging	Het
Prkag1	T	C	15: 98,815,887	T21A	possibly damaging	Het
Pygo1	C	A	9: 72,944,917	H129N	probably damaging	Het
Rad9a	A	T	19: 4,197,174	C271S	probably benign	Het
Reln	A	G	5: 21,948,512	F2265L	probably damaging	Het
Shc4	A	G	2: 125,629,727	I304T	probably damaging	Het
Slc35f3	T	A	8: 126,389,272	L313M	probably damaging	Het
Sycp2l	T	A	13: 41,129,861	M191K	possibly damaging	Het
Tmem132c	C	A	5: 127,553,135	Q579K	probably benign	Het
Trbj2-5	A	G	6: 41,543,460		probably benign	Het
Ttc38	A	G	15: 85,844,540	E231G	probably benign	Het
Utp20	A	G	10: 88,775,330	V1375A	probably benign	Het
Vcan	T	A	13: 89,703,977	T955S	probably damaging	Het
Vmn1r89	T	C	7: 13,219,387	C17R	possibly damaging	Het
Wnk1	A	G	6: 119,965,735		probably benign	Het
Zfp667	T	G	7: 6,305,950	I539S	possibly damaging	Het
Zfp738	T	A	13: 67,670,201	H557L	probably damaging	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTGCCTGCCATACAAGTAAG -3'
(R):5'- AAGTTCCCAGGATATGTCTAAGTGTC -3'

Sequencing Primer
(F):5'- CTGACAGCATCATCATTCCGTAGATG -3'
(R):5'- CTAAGTGTCAGTTCTCCAGGAGAC -3'

Posted On

2016-06-06