Incidental Mutation 'R5037:Kndc1'
ID389575
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139910455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: V291A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: V291A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121839
AA Change: V291A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: V291A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000151421
AA Change: V291A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116435
Gene: ENSMUSG00000066129
AA Change: V291A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7923:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7942:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTCAGCGAGAACACATGGAG -3'
(R):5'- AAGAACTCAGATATGGCCAGC -3'

Sequencing Primer
(F):5'- GCCTGCTCCAAGAAACGTG -3'
(R):5'- ACTCAGATATGGCCAGCTGGTTTC -3'
Posted On2016-06-06