Incidental Mutation 'R5037:Pygo1'
ID389582
Institutional Source Beutler Lab
Gene Symbol Pygo1
Ensembl Gene ENSMUSG00000034910
Gene Namepygopus 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72925645-72952181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72944917 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 129 (H129N)
Ref Sequence ENSEMBL: ENSMUSP00000044368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038489]
PDB Structure
Crystal Structure Analysis of the PHD domain of the Transcription Coactivator Pygophus [X-RAY DIFFRACTION]
Structural analysis of PHD domain of Pygopus complexed with trimethylated histone H3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000038489
AA Change: H129N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044368
Gene: ENSMUSG00000034910
AA Change: H129N

DomainStartEndE-ValueType
low complexity region 17 27 N/A INTRINSIC
Blast:HECTc 28 125 6e-28 BLAST
PHD 340 394 5.57e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and show no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Pygo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Pygo1 APN 9 72945288 missense probably damaging 1.00
IGL02033:Pygo1 APN 9 72945401 missense possibly damaging 0.59
IGL02445:Pygo1 APN 9 72925940 missense probably benign 0.12
IGL02751:Pygo1 APN 9 72945037 missense probably benign 0.09
IGL02938:Pygo1 APN 9 72944738 missense probably damaging 1.00
R1809:Pygo1 UTSW 9 72944796 missense probably damaging 1.00
R2190:Pygo1 UTSW 9 72945247 nonsense probably null
R5523:Pygo1 UTSW 9 72944984 missense possibly damaging 0.68
R5539:Pygo1 UTSW 9 72944779 missense probably damaging 1.00
R6163:Pygo1 UTSW 9 72944698 missense probably damaging 1.00
R6340:Pygo1 UTSW 9 72945429 missense probably damaging 1.00
R6803:Pygo1 UTSW 9 72942985 missense probably damaging 1.00
R7716:Pygo1 UTSW 9 72942926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAATCCGTTCGATGACAG -3'
(R):5'- ATGCGAGGTCAGGGTTAGAC -3'

Sequencing Primer
(F):5'- TCCGTTCGATGACAGCTACAAC -3'
(R):5'- GGGTTAGACACTTGGCCAACATTC -3'
Posted On2016-06-06