Incidental Mutation 'R5037:Coasy'
ID389586
Institutional Source Beutler Lab
Gene Symbol Coasy
Ensembl Gene ENSMUSG00000001755
Gene NameCoenzyme A synthase
SynonymsPpat, 1300003G02Rik, Ukr1, Dpck
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101082565-101086619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101084822 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 327 (E327G)
Ref Sequence ENSEMBL: ENSMUSP00000102929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001806] [ENSMUST00000017945] [ENSMUST00000019445] [ENSMUST00000107302] [ENSMUST00000107303] [ENSMUST00000107308] [ENSMUST00000149597]
Predicted Effect probably damaging
Transcript: ENSMUST00000001806
AA Change: E327G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755
AA Change: E327G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017945
SMART Domains Protein: ENSMUSP00000017945
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
HLH 135 193 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107302
SMART Domains Protein: ENSMUSP00000102923
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
HLH 81 139 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107303
SMART Domains Protein: ENSMUSP00000102924
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
HLH 51 109 8.13e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107308
AA Change: E327G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755
AA Change: E327G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149411
Predicted Effect probably benign
Transcript: ENSMUST00000149597
SMART Domains Protein: ENSMUSP00000121600
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:HLH 100 127 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151686
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the bifunctional protein coenzyme A (CoA) synthase which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this protein catalyzes the conversion of phosphopantetheine into dephospho-CoA while its dephospho-CoA kinase domain completes the final step by phosphorylating dephospho-CoA to form CoA. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Coasy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Coasy APN 11 101084358 missense possibly damaging 0.76
IGL02633:Coasy APN 11 101085321 missense probably damaging 1.00
R0946:Coasy UTSW 11 101085870 missense probably damaging 0.96
R1434:Coasy UTSW 11 101084996 unclassified probably benign
R2269:Coasy UTSW 11 101085882 missense probably benign 0.01
R2881:Coasy UTSW 11 101085849 missense possibly damaging 0.90
R5791:Coasy UTSW 11 101084385 unclassified probably null
R6523:Coasy UTSW 11 101086118 missense probably damaging 1.00
R6696:Coasy UTSW 11 101083101 missense possibly damaging 0.68
R6931:Coasy UTSW 11 101083581 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAGGGTGGAAGAACTTGTC -3'
(R):5'- GCCTCTCCTAAAGACAGGTAAG -3'

Sequencing Primer
(F):5'- CTTGTCTTGTCAAGTTCAGGAAC -3'
(R):5'- TCTCCTAAAGACAGGTAAGAGGGAAC -3'
Posted On2016-06-06