Incidental Mutation 'R5037:Kif13b'
ID389594
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 64758589 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 941 (Y941*)
Ref Sequence ENSEMBL: ENSMUSP00000153168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082508
Predicted Effect probably null
Transcript: ENSMUST00000100473
AA Change: Y941*
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: Y941*

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224503
AA Change: Y941*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGTTCACATCGCAGTTAATG -3'
(R):5'- CAGATGTACATGCAGACTGAGC -3'

Sequencing Primer
(F):5'- AGTTAATGACCATCTGTCCTCTGAGG -3'
(R):5'- TTGGATGATCCCCAAGTC -3'
Posted On2016-06-06