Incidental Mutation 'R5037:Htr1f'
ID389597
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64925928 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 334 (W334R)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect probably damaging
Transcript: ENSMUST00000063076
AA Change: W334R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: W334R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAAATATTACGAGCTGAGCTGC -3'
(R):5'- TCCCAGATCGGAACTGAAGC -3'

Sequencing Primer
(F):5'- CGAGCTGAGCTGCATAAATTATTTCC -3'
(R):5'- TCGGAACTGAAGCATGAGAAATCTTG -3'
Posted On2016-06-06