Incidental Mutation 'R5037:Rad9a'
ID389604
Institutional Source Beutler Lab
Gene Symbol Rad9a
Ensembl Gene ENSMUSG00000024824
Gene NameRAD9 checkpoint clamp component A
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4195198-4201603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4197174 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 271 (C271S)
Ref Sequence ENSEMBL: ENSMUSP00000025740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
AA Change: C271S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824
AA Change: C271S

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046094
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a knock-out allele are consistently smaller and display abnormal embryonic development and midgestational lethality associated with increased apoptosis and reduced cellular proliferation. Mutant mouse embryonic fibroblasts are not viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Rad9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Rad9a APN 19 4201337 missense probably benign 0.00
R0690:Rad9a UTSW 19 4197360 unclassified probably null
R1167:Rad9a UTSW 19 4197502 missense possibly damaging 0.91
R1823:Rad9a UTSW 19 4197242 missense probably damaging 1.00
R3725:Rad9a UTSW 19 4197695 missense probably damaging 1.00
R4468:Rad9a UTSW 19 4200294 missense probably benign 0.08
R4694:Rad9a UTSW 19 4200561 missense probably damaging 1.00
R4695:Rad9a UTSW 19 4200561 missense probably damaging 1.00
R4742:Rad9a UTSW 19 4200561 missense probably damaging 1.00
R4743:Rad9a UTSW 19 4200561 missense probably damaging 1.00
R4765:Rad9a UTSW 19 4200489 missense probably benign 0.28
R4824:Rad9a UTSW 19 4200537 missense probably benign
R4902:Rad9a UTSW 19 4201553 start gained probably benign
R5346:Rad9a UTSW 19 4201518 utr 5 prime probably null
R7532:Rad9a UTSW 19 4201523 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGGGATGCCTCTATGGATG -3'
(R):5'- GGCAGGTAATTCCAGGCTTTTAG -3'

Sequencing Primer
(F):5'- CAGCTGACCATTAAGGCTGG -3'
(R):5'- CTTTTAGACTGGGGAGAGGCAG -3'
Posted On2016-06-06