Mutagenetix > Incidental Mutations

Incidental Mutation 'R4998:Ucp1'

389643

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

042592-MU

Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4998 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83290352-83298452 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 83297855 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146] [ENSMUST00000034146] [ENSMUST00000034146]

Predicted Effect

probably null
Transcript: ENSMUST00000034146

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000034146

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000034146

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (91/94)

MGI Phenotype

Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	C	7: 27,571,663	V135A	probably damaging	Het
Ankrd42	T	C	7: 92,624,074	N115S	possibly damaging	Het
Baz1a	T	C	12: 54,975,137	E120G	probably damaging	Het
Calcrl	A	T	2: 84,339,314	V341E	probably damaging	Het
Card6	T	C	15: 5,100,082	R611G	probably benign	Het
Cd70	A	T	17: 57,146,311	S118T	probably damaging	Het
Chil5	T	A	3: 106,019,932	I188F	probably damaging	Het
Clca4b	C	T	3: 144,915,508	V602I	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Col6a4	A	G	9: 105,990,778		probably benign	Het
Cox8b	T	C	7: 140,899,088	E38G	probably damaging	Het
Cx3cl1	C	G	8: 94,780,425	L353V	probably damaging	Het
Cyp2a4	G	T	7: 26,307,361	Q48H	probably damaging	Het
Defb8	T	C	8: 19,447,587	I3V	probably benign	Het
Dip2a	A	T	10: 76,319,556	L65*	probably null	Het
Dsg2	A	T	18: 20,601,521	D852V	probably benign	Het
Dyx1c1	A	G	9: 72,960,678	T74A	possibly damaging	Het
Edar	T	C	10: 58,606,093	R326G	probably damaging	Het
Egfr	A	G	11: 16,881,493	E554G	possibly damaging	Het
Eif2b3	A	C	4: 117,066,392	K268T	probably benign	Het
Enox1	A	T	14: 77,501,435		probably benign	Het
Enpp3	C	A	10: 24,807,538	M260I	probably benign	Het
Espn	A	T	4: 152,135,583	M361K	possibly damaging	Het
Fam107a	T	C	14: 8,299,514	N108S	possibly damaging	Het
Fam57b	C	T	7: 126,827,623	R73C	probably damaging	Het
Fbn2	A	T	18: 58,072,631	V1125D	probably damaging	Het
Fbxo30	T	A	10: 11,290,763	S410T	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fuk	G	A	8: 110,887,803	A618V	probably damaging	Het
Gm10715	T	G	9: 3,038,073		probably benign	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm17416	C	A	2: 152,569,507	P57Q	probably damaging	Het
Gm27013	A	T	6: 130,676,538	C654S	probably damaging	Het
Gm9495	G	C	8: 69,453,358	N13K	probably benign	Het
Gon4l	G	T	3: 88,899,998	E1666D	probably damaging	Het
Gypa	T	A	8: 80,496,335	S23T	unknown	Het
Gys1	C	A	7: 45,451,544		probably benign	Het
Hdac10	T	A	15: 89,123,940	Q569L	possibly damaging	Het
Icos	A	G	1: 60,993,782	T47A	possibly damaging	Het
Igfn1	T	A	1: 135,954,666	I2814F	probably damaging	Het
Kif27	A	G	13: 58,293,143	S1153P	probably damaging	Het
Lin28a	A	C	4: 134,018,717	F9V	possibly damaging	Het
Lrriq3	T	A	3: 155,188,058	N465K	probably benign	Het
Lsm14a	T	C	7: 34,375,374	E47G	probably damaging	Het
Mmel1	A	G	4: 154,885,510	K177R	probably benign	Het
Ncstn	T	A	1: 172,071,520	N348I	possibly damaging	Het
Ninl	A	G	2: 150,953,364	I619T	probably damaging	Het
Npb	T	C	11: 120,608,575	Y23H	probably damaging	Het
Npepps	A	G	11: 97,206,107		probably benign	Het
Olfr1076	T	C	2: 86,509,355	Y299H	probably benign	Het
Otop1	G	A	5: 38,294,548		probably null	Het
Pcdha1	T	C	18: 36,932,416	L711P	probably damaging	Het
Pcyt1a	A	G	16: 32,451,842		probably benign	Het
Pdpr	G	T	8: 111,114,768	V211F	probably damaging	Het
Pip4k2b	T	C	11: 97,722,435	N245S	possibly damaging	Het
Platr26	G	A	2: 71,730,870		noncoding transcript	Het
Plek	A	G	11: 16,983,194		probably null	Het
Prdm15	A	T	16: 97,794,489	D1046E	probably damaging	Het
Prr29	T	G	11: 106,376,953	C175G	probably benign	Het
Ptpru	A	G	4: 131,776,885	V1097A	probably damaging	Het
Ramp2	T	A	11: 101,247,421		probably benign	Het
Rap1gap	A	G	4: 137,728,284	D381G	possibly damaging	Het
Rbbp6	T	A	7: 122,990,326	D412E	probably benign	Het
Rgs4	C	T	1: 169,745,233	V45I	probably benign	Het
Ryr2	C	T	13: 11,643,895	R3614Q	probably damaging	Het
Shc3	G	A	13: 51,442,820		probably null	Het
Shmt2	A	T	10: 127,518,270	C412S	probably damaging	Het
Slc25a45	A	T	19: 5,884,917	N265Y	probably damaging	Het
Slc4a10	G	C	2: 62,244,439	E316Q	probably benign	Het
Slc5a8	T	C	10: 88,908,057		probably null	Het
Snx31	A	G	15: 36,539,367	V121A	probably damaging	Het
Socs3	T	C	11: 117,967,716	E172G	probably damaging	Het
Tg	A	G	15: 66,674,050	D207G	probably damaging	Het
Them4	G	T	3: 94,329,781	V183F	probably damaging	Het
Tkt	G	A	14: 30,565,542	W136*	probably null	Het
Tmc3	C	A	7: 83,622,321	R894S	probably benign	Het
Tmem132a	G	T	19: 10,858,941	P742T	probably benign	Het
Tmem202	A	G	9: 59,524,846	L66P	probably damaging	Het
Trbc1	G	A	6: 41,539,336		probably benign	Het
Trhr2	A	G	8: 122,358,772	F158L	probably benign	Het
Ttc13	A	T	8: 124,680,056	N595K	probably damaging	Het
Zbtb4	C	T	11: 69,778,671	T740I	probably benign	Het
Zfp69	A	T	4: 120,947,325	D116E	possibly damaging	Het
Zfp879	A	G	11: 50,837,969	L66S	probably damaging	Het
Zfp955b	T	A	17: 33,305,151		probably benign	Het
Zfyve1	T	C	12: 83,548,065	I718V	possibly damaging	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	83293948	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	83294228	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	83290604	nonsense	probably null
R0055:Ucp1	UTSW	8	83290604	nonsense	probably null
R0505:Ucp1	UTSW	8	83295307	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	83291603	splice site	probably benign
R0681:Ucp1	UTSW	8	83295307	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	83297847	splice site	probably benign
R1606:Ucp1	UTSW	8	83295304	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	83290688	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	83297867	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	83294032	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	83290641	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	83293951	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	83295247	missense	probably damaging	1.00
R5163:Ucp1	UTSW	8	83294203	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	83290691	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	83297891	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	83293938	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	83294089	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	83291477	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	83293902	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	83295252	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	83297892	missense	probably benign	0.19
R7961:Ucp1	UTSW	8	83297892	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	83294011	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- CTCCAAAGGAGGGAAGTGTTGC -3'
(R):5'- GTGGTCTCCCAGCATAGAAG -3'

Sequencing Primer
(F):5'- CCATTGCTTCAGCTCTGTGGG -3'
(R):5'- GCATAGAAGCCCAATGATGTTC -3'

Posted On

2016-06-06