Mutagenetix > Incidental Mutation

Incidental Mutation 'R4998:Col6a4'

389651

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

042592-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4998 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

A to G at 105990778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

probably benign
Transcript: ENSMUST00000121963

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149207

Predicted Effect

probably benign
Transcript: ENSMUST00000218471

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (91/94)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	C	7: 27,571,663	V135A	probably damaging	Het
Ankrd42	T	C	7: 92,624,074	N115S	possibly damaging	Het
Baz1a	T	C	12: 54,975,137	E120G	probably damaging	Het
Calcrl	A	T	2: 84,339,314	V341E	probably damaging	Het
Card6	T	C	15: 5,100,082	R611G	probably benign	Het
Cd70	A	T	17: 57,146,311	S118T	probably damaging	Het
Chil5	T	A	3: 106,019,932	I188F	probably damaging	Het
Clca4b	C	T	3: 144,915,508	V602I	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cox8b	T	C	7: 140,899,088	E38G	probably damaging	Het
Cx3cl1	C	G	8: 94,780,425	L353V	probably damaging	Het
Cyp2a4	G	T	7: 26,307,361	Q48H	probably damaging	Het
Defb8	T	C	8: 19,447,587	I3V	probably benign	Het
Dip2a	A	T	10: 76,319,556	L65*	probably null	Het
Dsg2	A	T	18: 20,601,521	D852V	probably benign	Het
Dyx1c1	A	G	9: 72,960,678	T74A	possibly damaging	Het
Edar	T	C	10: 58,606,093	R326G	probably damaging	Het
Egfr	A	G	11: 16,881,493	E554G	possibly damaging	Het
Eif2b3	A	C	4: 117,066,392	K268T	probably benign	Het
Enox1	A	T	14: 77,501,435		probably benign	Het
Enpp3	C	A	10: 24,807,538	M260I	probably benign	Het
Espn	A	T	4: 152,135,583	M361K	possibly damaging	Het
Fam107a	T	C	14: 8,299,514	N108S	possibly damaging	Het
Fam57b	C	T	7: 126,827,623	R73C	probably damaging	Het
Fbn2	A	T	18: 58,072,631	V1125D	probably damaging	Het
Fbxo30	T	A	10: 11,290,763	S410T	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fuk	G	A	8: 110,887,803	A618V	probably damaging	Het
Gm10715	T	G	9: 3,038,073		probably benign	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm17416	C	A	2: 152,569,507	P57Q	probably damaging	Het
Gm27013	A	T	6: 130,676,538	C654S	probably damaging	Het
Gm9495	G	C	8: 69,453,358	N13K	probably benign	Het
Gon4l	G	T	3: 88,899,998	E1666D	probably damaging	Het
Gypa	T	A	8: 80,496,335	S23T	unknown	Het
Gys1	C	A	7: 45,451,544		probably benign	Het
Hdac10	T	A	15: 89,123,940	Q569L	possibly damaging	Het
Icos	A	G	1: 60,993,782	T47A	possibly damaging	Het
Igfn1	T	A	1: 135,954,666	I2814F	probably damaging	Het
Kif27	A	G	13: 58,293,143	S1153P	probably damaging	Het
Lin28a	A	C	4: 134,018,717	F9V	possibly damaging	Het
Lrriq3	T	A	3: 155,188,058	N465K	probably benign	Het
Lsm14a	T	C	7: 34,375,374	E47G	probably damaging	Het
Mmel1	A	G	4: 154,885,510	K177R	probably benign	Het
Ncstn	T	A	1: 172,071,520	N348I	possibly damaging	Het
Ninl	A	G	2: 150,953,364	I619T	probably damaging	Het
Npb	T	C	11: 120,608,575	Y23H	probably damaging	Het
Npepps	A	G	11: 97,206,107		probably benign	Het
Olfr1076	T	C	2: 86,509,355	Y299H	probably benign	Het
Otop1	G	A	5: 38,294,548		probably null	Het
Pcdha1	T	C	18: 36,932,416	L711P	probably damaging	Het
Pcyt1a	A	G	16: 32,451,842		probably benign	Het
Pdpr	G	T	8: 111,114,768	V211F	probably damaging	Het
Pip4k2b	T	C	11: 97,722,435	N245S	possibly damaging	Het
Platr26	G	A	2: 71,730,870		noncoding transcript	Het
Plek	A	G	11: 16,983,194		probably null	Het
Prdm15	A	T	16: 97,794,489	D1046E	probably damaging	Het
Prr29	T	G	11: 106,376,953	C175G	probably benign	Het
Ptpru	A	G	4: 131,776,885	V1097A	probably damaging	Het
Ramp2	T	A	11: 101,247,421		probably benign	Het
Rap1gap	A	G	4: 137,728,284	D381G	possibly damaging	Het
Rbbp6	T	A	7: 122,990,326	D412E	probably benign	Het
Rgs4	C	T	1: 169,745,233	V45I	probably benign	Het
Ryr2	C	T	13: 11,643,895	R3614Q	probably damaging	Het
Shc3	G	A	13: 51,442,820		probably null	Het
Shmt2	A	T	10: 127,518,270	C412S	probably damaging	Het
Slc25a45	A	T	19: 5,884,917	N265Y	probably damaging	Het
Slc4a10	G	C	2: 62,244,439	E316Q	probably benign	Het
Slc5a8	T	C	10: 88,908,057		probably null	Het
Snx31	A	G	15: 36,539,367	V121A	probably damaging	Het
Socs3	T	C	11: 117,967,716	E172G	probably damaging	Het
Tg	A	G	15: 66,674,050	D207G	probably damaging	Het
Them4	G	T	3: 94,329,781	V183F	probably damaging	Het
Tkt	G	A	14: 30,565,542	W136*	probably null	Het
Tmc3	C	A	7: 83,622,321	R894S	probably benign	Het
Tmem132a	G	T	19: 10,858,941	P742T	probably benign	Het
Tmem202	A	G	9: 59,524,846	L66P	probably damaging	Het
Trbc1	G	A	6: 41,539,336		probably benign	Het
Trhr2	A	G	8: 122,358,772	F158L	probably benign	Het
Ttc13	A	T	8: 124,680,056	N595K	probably damaging	Het
Ucp1	A	G	8: 83,297,855		probably null	Het
Zbtb4	C	T	11: 69,778,671	T740I	probably benign	Het
Zfp69	A	T	4: 120,947,325	D116E	possibly damaging	Het
Zfp879	A	G	11: 50,837,969	L66S	probably damaging	Het
Zfp955b	T	A	17: 33,305,151		probably benign	Het
Zfyve1	T	C	12: 83,548,065	I718V	possibly damaging	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCTCAGCAAGGGTAACGC -3'
(R):5'- CATGTGACTTACTGTACTACACTTGTG -3'

Sequencing Primer
(F):5'- AAGGGTAACGCCAGTCTCACTG -3'
(R):5'- TCGAGGCTCAGACAGGATCATTATC -3'

Posted On

2016-06-06