Mutagenetix > Incidental Mutation

Incidental Mutation 'R4998:Enpp3'

389653

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

042592-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R4998 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 24807538 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 260 (M260I)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]

AlphaFold

Q6DYE8

Predicted Effect

probably benign
Transcript: ENSMUST00000020169
AA Change: M260I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: M260I

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Predicted Effect

probably benign
Transcript: ENSMUST00000219342

Meta Mutation Damage Score

0.1040

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (91/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	C	7: 27,571,663	V135A	probably damaging	Het
Ankrd42	T	C	7: 92,624,074	N115S	possibly damaging	Het
Baz1a	T	C	12: 54,975,137	E120G	probably damaging	Het
Calcrl	A	T	2: 84,339,314	V341E	probably damaging	Het
Card6	T	C	15: 5,100,082	R611G	probably benign	Het
Cd70	A	T	17: 57,146,311	S118T	probably damaging	Het
Chil5	T	A	3: 106,019,932	I188F	probably damaging	Het
Clca4b	C	T	3: 144,915,508	V602I	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Col6a4	A	G	9: 105,990,778		probably benign	Het
Cox8b	T	C	7: 140,899,088	E38G	probably damaging	Het
Cx3cl1	C	G	8: 94,780,425	L353V	probably damaging	Het
Cyp2a4	G	T	7: 26,307,361	Q48H	probably damaging	Het
Defb8	T	C	8: 19,447,587	I3V	probably benign	Het
Dip2a	A	T	10: 76,319,556	L65*	probably null	Het
Dsg2	A	T	18: 20,601,521	D852V	probably benign	Het
Dyx1c1	A	G	9: 72,960,678	T74A	possibly damaging	Het
Edar	T	C	10: 58,606,093	R326G	probably damaging	Het
Egfr	A	G	11: 16,881,493	E554G	possibly damaging	Het
Eif2b3	A	C	4: 117,066,392	K268T	probably benign	Het
Enox1	A	T	14: 77,501,435		probably benign	Het
Espn	A	T	4: 152,135,583	M361K	possibly damaging	Het
Fam107a	T	C	14: 8,299,514	N108S	possibly damaging	Het
Fam57b	C	T	7: 126,827,623	R73C	probably damaging	Het
Fbn2	A	T	18: 58,072,631	V1125D	probably damaging	Het
Fbxo30	T	A	10: 11,290,763	S410T	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fuk	G	A	8: 110,887,803	A618V	probably damaging	Het
Gm10715	T	G	9: 3,038,073		probably benign	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm17416	C	A	2: 152,569,507	P57Q	probably damaging	Het
Gm27013	A	T	6: 130,676,538	C654S	probably damaging	Het
Gm9495	G	C	8: 69,453,358	N13K	probably benign	Het
Gon4l	G	T	3: 88,899,998	E1666D	probably damaging	Het
Gypa	T	A	8: 80,496,335	S23T	unknown	Het
Gys1	C	A	7: 45,451,544		probably benign	Het
Hdac10	T	A	15: 89,123,940	Q569L	possibly damaging	Het
Icos	A	G	1: 60,993,782	T47A	possibly damaging	Het
Igfn1	T	A	1: 135,954,666	I2814F	probably damaging	Het
Kif27	A	G	13: 58,293,143	S1153P	probably damaging	Het
Lin28a	A	C	4: 134,018,717	F9V	possibly damaging	Het
Lrriq3	T	A	3: 155,188,058	N465K	probably benign	Het
Lsm14a	T	C	7: 34,375,374	E47G	probably damaging	Het
Mmel1	A	G	4: 154,885,510	K177R	probably benign	Het
Ncstn	T	A	1: 172,071,520	N348I	possibly damaging	Het
Ninl	A	G	2: 150,953,364	I619T	probably damaging	Het
Npb	T	C	11: 120,608,575	Y23H	probably damaging	Het
Npepps	A	G	11: 97,206,107		probably benign	Het
Olfr1076	T	C	2: 86,509,355	Y299H	probably benign	Het
Otop1	G	A	5: 38,294,548		probably null	Het
Pcdha1	T	C	18: 36,932,416	L711P	probably damaging	Het
Pcyt1a	A	G	16: 32,451,842		probably benign	Het
Pdpr	G	T	8: 111,114,768	V211F	probably damaging	Het
Pip4k2b	T	C	11: 97,722,435	N245S	possibly damaging	Het
Platr26	G	A	2: 71,730,870		noncoding transcript	Het
Plek	A	G	11: 16,983,194		probably null	Het
Prdm15	A	T	16: 97,794,489	D1046E	probably damaging	Het
Prr29	T	G	11: 106,376,953	C175G	probably benign	Het
Ptpru	A	G	4: 131,776,885	V1097A	probably damaging	Het
Ramp2	T	A	11: 101,247,421		probably benign	Het
Rap1gap	A	G	4: 137,728,284	D381G	possibly damaging	Het
Rbbp6	T	A	7: 122,990,326	D412E	probably benign	Het
Rgs4	C	T	1: 169,745,233	V45I	probably benign	Het
Ryr2	C	T	13: 11,643,895	R3614Q	probably damaging	Het
Shc3	G	A	13: 51,442,820		probably null	Het
Shmt2	A	T	10: 127,518,270	C412S	probably damaging	Het
Slc25a45	A	T	19: 5,884,917	N265Y	probably damaging	Het
Slc4a10	G	C	2: 62,244,439	E316Q	probably benign	Het
Slc5a8	T	C	10: 88,908,057		probably null	Het
Snx31	A	G	15: 36,539,367	V121A	probably damaging	Het
Socs3	T	C	11: 117,967,716	E172G	probably damaging	Het
Tg	A	G	15: 66,674,050	D207G	probably damaging	Het
Them4	G	T	3: 94,329,781	V183F	probably damaging	Het
Tkt	G	A	14: 30,565,542	W136*	probably null	Het
Tmc3	C	A	7: 83,622,321	R894S	probably benign	Het
Tmem132a	G	T	19: 10,858,941	P742T	probably benign	Het
Tmem202	A	G	9: 59,524,846	L66P	probably damaging	Het
Trbc1	G	A	6: 41,539,336		probably benign	Het
Trhr2	A	G	8: 122,358,772	F158L	probably benign	Het
Ttc13	A	T	8: 124,680,056	N595K	probably damaging	Het
Ucp1	A	G	8: 83,297,855		probably null	Het
Zbtb4	C	T	11: 69,778,671	T740I	probably benign	Het
Zfp69	A	T	4: 120,947,325	D116E	possibly damaging	Het
Zfp879	A	G	11: 50,837,969	L66S	probably damaging	Het
Zfp955b	T	A	17: 33,305,151		probably benign	Het
Zfyve1	T	C	12: 83,548,065	I718V	possibly damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTATGATAGAAGAGAACTGACCC -3'
(R):5'- AGTACGCGCACGATTCTATC -3'

Sequencing Primer
(F):5'- TGATAGAAGAGAACTGACCCTCTAC -3'
(R):5'- ATGAACTGTTACTACCTTACTCCATG -3'

Posted On

2016-06-06