Mutagenetix > Incidental Mutations

Incidental Mutation 'R4998:Egfr'

389658

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

042592-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.906) question?

Stock #

R4998 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16881493 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 554 (E554G)

Ref Sequence

ENSEMBL: ENSMUSP00000099948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884] [ENSMUST00000125984]

Predicted Effect

probably benign
Transcript: ENSMUST00000020329
AA Change: E554G

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: E554G

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102884
AA Change: E554G

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: E554G

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	5e-33	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	2e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.54e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125984
AA Change: E47G

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122632
Gene: ENSMUSG00000020122
AA Change: E47G

Domain	Start	End	E-Value	Type
FU	1	40	2.55e0	SMART
FU	45	94	4.38e-10	SMART

Meta Mutation Damage Score

0.0798

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

97% (91/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	C	7: 27,571,663	V135A	probably damaging	Het
Ankrd42	T	C	7: 92,624,074	N115S	possibly damaging	Het
Baz1a	T	C	12: 54,975,137	E120G	probably damaging	Het
Calcrl	A	T	2: 84,339,314	V341E	probably damaging	Het
Card6	T	C	15: 5,100,082	R611G	probably benign	Het
Cd70	A	T	17: 57,146,311	S118T	probably damaging	Het
Chil5	T	A	3: 106,019,932	I188F	probably damaging	Het
Clca4b	C	T	3: 144,915,508	V602I	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Col6a4	A	G	9: 105,990,778		probably benign	Het
Cox8b	T	C	7: 140,899,088	E38G	probably damaging	Het
Cx3cl1	C	G	8: 94,780,425	L353V	probably damaging	Het
Cyp2a4	G	T	7: 26,307,361	Q48H	probably damaging	Het
Defb8	T	C	8: 19,447,587	I3V	probably benign	Het
Dip2a	A	T	10: 76,319,556	L65*	probably null	Het
Dsg2	A	T	18: 20,601,521	D852V	probably benign	Het
Dyx1c1	A	G	9: 72,960,678	T74A	possibly damaging	Het
Edar	T	C	10: 58,606,093	R326G	probably damaging	Het
Eif2b3	A	C	4: 117,066,392	K268T	probably benign	Het
Enox1	A	T	14: 77,501,435		probably benign	Het
Enpp3	C	A	10: 24,807,538	M260I	probably benign	Het
Espn	A	T	4: 152,135,583	M361K	possibly damaging	Het
Fam107a	T	C	14: 8,299,514	N108S	possibly damaging	Het
Fam57b	C	T	7: 126,827,623	R73C	probably damaging	Het
Fbn2	A	T	18: 58,072,631	V1125D	probably damaging	Het
Fbxo30	T	A	10: 11,290,763	S410T	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fuk	G	A	8: 110,887,803	A618V	probably damaging	Het
Gm10715	T	G	9: 3,038,073		probably benign	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm17416	C	A	2: 152,569,507	P57Q	probably damaging	Het
Gm27013	A	T	6: 130,676,538	C654S	probably damaging	Het
Gm9495	G	C	8: 69,453,358	N13K	probably benign	Het
Gon4l	G	T	3: 88,899,998	E1666D	probably damaging	Het
Gypa	T	A	8: 80,496,335	S23T	unknown	Het
Gys1	C	A	7: 45,451,544		probably benign	Het
Hdac10	T	A	15: 89,123,940	Q569L	possibly damaging	Het
Icos	A	G	1: 60,993,782	T47A	possibly damaging	Het
Igfn1	T	A	1: 135,954,666	I2814F	probably damaging	Het
Kif27	A	G	13: 58,293,143	S1153P	probably damaging	Het
Lin28a	A	C	4: 134,018,717	F9V	possibly damaging	Het
Lrriq3	T	A	3: 155,188,058	N465K	probably benign	Het
Lsm14a	T	C	7: 34,375,374	E47G	probably damaging	Het
Mmel1	A	G	4: 154,885,510	K177R	probably benign	Het
Ncstn	T	A	1: 172,071,520	N348I	possibly damaging	Het
Ninl	A	G	2: 150,953,364	I619T	probably damaging	Het
Npb	T	C	11: 120,608,575	Y23H	probably damaging	Het
Npepps	A	G	11: 97,206,107		probably benign	Het
Olfr1076	T	C	2: 86,509,355	Y299H	probably benign	Het
Otop1	G	A	5: 38,294,548		probably null	Het
Pcdha1	T	C	18: 36,932,416	L711P	probably damaging	Het
Pcyt1a	A	G	16: 32,451,842		probably benign	Het
Pdpr	G	T	8: 111,114,768	V211F	probably damaging	Het
Pip4k2b	T	C	11: 97,722,435	N245S	possibly damaging	Het
Platr26	G	A	2: 71,730,870		noncoding transcript	Het
Plek	A	G	11: 16,983,194		probably null	Het
Prdm15	A	T	16: 97,794,489	D1046E	probably damaging	Het
Prr29	T	G	11: 106,376,953	C175G	probably benign	Het
Ptpru	A	G	4: 131,776,885	V1097A	probably damaging	Het
Ramp2	T	A	11: 101,247,421		probably benign	Het
Rap1gap	A	G	4: 137,728,284	D381G	possibly damaging	Het
Rbbp6	T	A	7: 122,990,326	D412E	probably benign	Het
Rgs4	C	T	1: 169,745,233	V45I	probably benign	Het
Ryr2	C	T	13: 11,643,895	R3614Q	probably damaging	Het
Shc3	G	A	13: 51,442,820		probably null	Het
Shmt2	A	T	10: 127,518,270	C412S	probably damaging	Het
Slc25a45	A	T	19: 5,884,917	N265Y	probably damaging	Het
Slc4a10	G	C	2: 62,244,439	E316Q	probably benign	Het
Slc5a8	T	C	10: 88,908,057		probably null	Het
Snx31	A	G	15: 36,539,367	V121A	probably damaging	Het
Socs3	T	C	11: 117,967,716	E172G	probably damaging	Het
Tg	A	G	15: 66,674,050	D207G	probably damaging	Het
Them4	G	T	3: 94,329,781	V183F	probably damaging	Het
Tkt	G	A	14: 30,565,542	W136*	probably null	Het
Tmc3	C	A	7: 83,622,321	R894S	probably benign	Het
Tmem132a	G	T	19: 10,858,941	P742T	probably benign	Het
Tmem202	A	G	9: 59,524,846	L66P	probably damaging	Het
Trbc1	G	A	6: 41,539,336		probably benign	Het
Trhr2	A	G	8: 122,358,772	F158L	probably benign	Het
Ttc13	A	T	8: 124,680,056	N595K	probably damaging	Het
Ucp1	A	G	8: 83,297,855		probably null	Het
Zbtb4	C	T	11: 69,778,671	T740I	probably benign	Het
Zfp69	A	T	4: 120,947,325	D116E	possibly damaging	Het
Zfp879	A	G	11: 50,837,969	L66S	probably damaging	Het
Zfp955b	T	A	17: 33,305,151		probably benign	Het
Zfyve1	T	C	12: 83,548,065	I718V	possibly damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTTCTGTTAGTAGACCTCAGC -3'
(R):5'- ATGGCCACCTTTCATGATCAG -3'

Sequencing Primer
(F):5'- GACCTCAGCACATTATATTTCAAAGC -3'
(R):5'- TCATGATCAGACCAGGGGCATTTC -3'

Posted On

2016-06-06