Incidental Mutation 'R4999:Tbx15'
ID 389701
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 042593-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R4999 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99223649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 279 (T279K)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T279K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150756
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,139,022 (GRCm39) probably null Het
Abca4 T A 3: 121,899,019 (GRCm39) V667D probably damaging Het
Aco1 A G 4: 40,176,507 (GRCm39) I224V probably damaging Het
Arel1 C T 12: 84,978,541 (GRCm39) V364M probably damaging Het
Arhgap42 A G 9: 9,009,435 (GRCm39) V484A probably damaging Het
Asap2 T C 12: 21,302,766 (GRCm39) F681L probably benign Het
Atrn C A 2: 130,817,874 (GRCm39) D809E probably damaging Het
Ccdc70 G A 8: 22,463,266 (GRCm39) V19M possibly damaging Het
Ccp110 G T 7: 118,329,235 (GRCm39) E73* probably null Het
Cfap57 A C 4: 118,453,045 (GRCm39) S553A probably benign Het
Cftr A G 6: 18,221,613 (GRCm39) K212E probably benign Het
Chkb A T 15: 89,312,368 (GRCm39) Y216N probably damaging Het
Cntnap2 G T 6: 45,897,768 (GRCm39) D149Y probably damaging Het
Cpd A G 11: 76,737,048 (GRCm39) probably null Het
Creb3l1 C T 2: 91,813,571 (GRCm39) D489N probably benign Het
Crhbp A G 13: 95,578,753 (GRCm39) F123L probably damaging Het
Cryab T C 9: 50,665,909 (GRCm39) V100A possibly damaging Het
Csmd2 T C 4: 128,415,723 (GRCm39) I2684T probably benign Het
Ctbp2 G T 7: 132,616,378 (GRCm39) P186T possibly damaging Het
Ctnna2 T C 6: 76,892,745 (GRCm39) N814S possibly damaging Het
Dntt T C 19: 41,028,295 (GRCm39) V197A probably damaging Het
Fam135a G A 1: 24,059,758 (GRCm39) A1187V possibly damaging Het
Filip1l A T 16: 57,390,778 (GRCm39) Q455H probably benign Het
Grm2 T C 9: 106,531,189 (GRCm39) E100G probably damaging Het
Gtf2ird2 G A 5: 134,246,306 (GRCm39) V855M probably damaging Het
Heatr9 A T 11: 83,409,618 (GRCm39) I118N possibly damaging Het
Htra3 T C 5: 35,828,469 (GRCm39) H137R probably benign Het
Iars1 A G 13: 49,863,137 (GRCm39) S530G probably damaging Het
Klhdc4 T A 8: 122,523,342 (GRCm39) M510L probably benign Het
Lipc T C 9: 70,724,013 (GRCm39) T204A probably benign Het
Lrp1 A G 10: 127,389,648 (GRCm39) V3129A probably damaging Het
Macf1 G A 4: 123,388,702 (GRCm39) T1120I probably benign Het
Maco1 A G 4: 134,555,444 (GRCm39) I343T probably benign Het
Map4 T C 9: 109,867,445 (GRCm39) probably benign Het
Mbtps1 A T 8: 120,260,087 (GRCm39) V420D probably damaging Het
Mta2 G T 19: 8,927,747 (GRCm39) D523Y probably benign Het
Mtcl2 C T 2: 156,864,776 (GRCm39) G1144D probably benign Het
Muc4 A G 16: 32,576,670 (GRCm39) probably benign Het
Mug1 C T 6: 121,855,902 (GRCm39) Q965* probably null Het
Myo1e T A 9: 70,260,594 (GRCm39) I584N probably damaging Het
Nolc1 T C 19: 46,067,359 (GRCm39) V80A probably damaging Het
Nop56 G T 2: 130,117,645 (GRCm39) V91L probably benign Het
Or5b99 A T 19: 12,976,583 (GRCm39) M78L probably benign Het
Or5h23 A T 16: 58,906,765 (GRCm39) L27Q probably damaging Het
Or6f2 T C 7: 139,756,933 (GRCm39) V300A probably damaging Het
Osbpl3 T C 6: 50,313,277 (GRCm39) E107G probably damaging Het
Pde3a T A 6: 141,195,751 (GRCm39) C146S probably benign Het
Pfkm A G 15: 98,026,123 (GRCm39) M573V probably damaging Het
Pkd1l2 C T 8: 117,774,113 (GRCm39) probably null Het
Plekhg3 T C 12: 76,612,021 (GRCm39) I374T possibly damaging Het
Ppig T A 2: 69,571,830 (GRCm39) V183D unknown Het
Prom1 T G 5: 44,194,876 (GRCm39) I290L probably benign Het
Rufy3 T A 5: 88,785,085 (GRCm39) M387K probably damaging Het
Selenoo G A 15: 88,978,387 (GRCm39) R270H probably damaging Het
Sema3d T A 5: 12,558,054 (GRCm39) probably null Het
Sema6c C T 3: 95,075,674 (GRCm39) T175I probably damaging Het
Serpina3k T C 12: 104,307,305 (GRCm39) I179T probably damaging Het
Sf3b3 T C 8: 111,567,835 (GRCm39) T207A probably benign Het
Slc22a26 C A 19: 7,779,546 (GRCm39) R90L probably damaging Het
Slitrk5 T C 14: 111,917,648 (GRCm39) V424A probably damaging Het
Smarca2 G T 19: 26,698,255 (GRCm39) E89* probably null Het
Stab2 T A 10: 86,773,773 (GRCm39) S853C probably damaging Het
Stk17b A T 1: 53,800,306 (GRCm39) probably null Het
Taar5 T A 10: 23,847,445 (GRCm39) I281N possibly damaging Het
Tars3 A T 7: 65,308,683 (GRCm39) E284D probably damaging Het
Tfr2 G A 5: 137,585,187 (GRCm39) V740I probably benign Het
Tlr12 T C 4: 128,511,473 (GRCm39) E259G probably benign Het
Tmem145 A G 7: 25,008,459 (GRCm39) T302A probably benign Het
Trappc14 T A 5: 138,259,884 (GRCm39) T391S probably damaging Het
Trpa1 G T 1: 14,946,085 (GRCm39) H1015Q probably benign Het
Tspan8 A G 10: 115,653,534 (GRCm39) Y10C possibly damaging Het
Ttll7 A G 3: 146,600,224 (GRCm39) N44S probably damaging Het
Uba7 T C 9: 107,857,038 (GRCm39) probably null Het
Ube2j2 G A 4: 156,030,841 (GRCm39) M1I probably null Het
Ubr5 C A 15: 38,009,912 (GRCm39) A1022S probably benign Het
Usf1 T G 1: 171,243,331 (GRCm39) I36S probably damaging Het
Vmn1r181 A T 7: 23,683,790 (GRCm39) D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 (GRCm39) Y99* probably null Het
Vmn1r72 T C 7: 11,404,300 (GRCm39) I49M possibly damaging Het
Vmn2r99 A G 17: 19,582,397 (GRCm39) M1V probably null Het
Vsig10 T A 5: 117,482,040 (GRCm39) V410E probably damaging Het
Zc3h7b A G 15: 81,663,334 (GRCm39) Y442C probably damaging Het
Zfyve26 G T 12: 79,327,159 (GRCm39) Y730* probably null Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGCCCAGCCTAAACTTTC -3'
(R):5'- GTGCTATAAGACTGGTCTCTCC -3'

Sequencing Primer
(F):5'- GCCCAGCCTAAACTTTCCTCTTTG -3'
(R):5'- AAGTTCTGCTCATACCTCTGGGAG -3'
Posted On 2016-06-06