Mutagenetix > Incidental Mutation

Incidental Mutation 'R4999:Tbx15'

389701

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

042593-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4999 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 99316333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 279 (T279K)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T279K

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	A	G	1: 16,068,798		probably null	Het
Abca4	T	A	3: 122,105,370	V667D	probably damaging	Het
Aco1	A	G	4: 40,176,507	I224V	probably damaging	Het
Arel1	C	T	12: 84,931,767	V364M	probably damaging	Het
Arhgap42	A	G	9: 9,009,434	V484A	probably damaging	Het
Asap2	T	C	12: 21,252,765	F681L	probably benign	Het
Atrn	C	A	2: 130,975,954	D809E	probably damaging	Het
BC037034	T	A	5: 138,261,622	T391S	probably damaging	Het
Ccdc70	G	A	8: 21,973,250	V19M	possibly damaging	Het
Ccp110	G	T	7: 118,730,012	E73*	probably null	Het
Cfap57	A	C	4: 118,595,848	S553A	probably benign	Het
Cftr	A	G	6: 18,221,614	K212E	probably benign	Het
Chkb	A	T	15: 89,428,165	Y216N	probably damaging	Het
Cntnap2	G	T	6: 45,920,834	D149Y	probably damaging	Het
Cpd	A	G	11: 76,846,222		probably null	Het
Creb3l1	C	T	2: 91,983,226	D489N	probably benign	Het
Crhbp	A	G	13: 95,442,245	F123L	probably damaging	Het
Cryab	T	C	9: 50,754,609	V100A	possibly damaging	Het
Csmd2	T	C	4: 128,521,930	I2684T	probably benign	Het
Ctbp2	G	T	7: 133,014,649	P186T	possibly damaging	Het
Ctnna2	T	C	6: 76,915,762	N814S	possibly damaging	Het
Dntt	T	C	19: 41,039,856	V197A	probably damaging	Het
Fam135a	G	A	1: 24,020,677	A1187V	possibly damaging	Het
Filip1l	A	T	16: 57,570,415	Q455H	probably benign	Het
Grm2	T	C	9: 106,653,990	E100G	probably damaging	Het
Gtf2ird2	G	A	5: 134,217,464	V855M	probably damaging	Het
Heatr9	A	T	11: 83,518,792	I118N	possibly damaging	Het
Htra3	T	C	5: 35,671,125	H137R	probably benign	Het
Iars	A	G	13: 49,709,661	S530G	probably damaging	Het
Klhdc4	T	A	8: 121,796,603	M510L	probably benign	Het
Lipc	T	C	9: 70,816,731	T204A	probably benign	Het
Lrp1	A	G	10: 127,553,779	V3129A	probably damaging	Het
Macf1	G	A	4: 123,494,909	T1120I	probably benign	Het
Map4	T	C	9: 110,038,377		probably benign	Het
Mbtps1	A	T	8: 119,533,348	V420D	probably damaging	Het
Mta2	G	T	19: 8,950,383	D523Y	probably benign	Het
Muc4	A	G	16: 32,756,296		probably benign	Het
Mug1	C	T	6: 121,878,943	Q965*	probably null	Het
Myo1e	T	A	9: 70,353,312	I584N	probably damaging	Het
Nolc1	T	C	19: 46,078,920	V80A	probably damaging	Het
Nop56	G	T	2: 130,275,725	V91L	probably benign	Het
Olfr1451	A	T	19: 12,999,219	M78L	probably benign	Het
Olfr191	A	T	16: 59,086,402	L27Q	probably damaging	Het
Olfr523	T	C	7: 140,177,020	V300A	probably damaging	Het
Osbpl3	T	C	6: 50,336,297	E107G	probably damaging	Het
Pde3a	T	A	6: 141,250,025	C146S	probably benign	Het
Pfkm	A	G	15: 98,128,242	M573V	probably damaging	Het
Pkd1l2	C	T	8: 117,047,374		probably null	Het
Plekhg3	T	C	12: 76,565,247	I374T	possibly damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Prom1	T	G	5: 44,037,534	I290L	probably benign	Het
Rufy3	T	A	5: 88,637,226	M387K	probably damaging	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	T	A	5: 12,508,087		probably null	Het
Sema6c	C	T	3: 95,168,363	T175I	probably damaging	Het
Serpina3k	T	C	12: 104,341,046	I179T	probably damaging	Het
Sf3b3	T	C	8: 110,841,203	T207A	probably benign	Het
Slc22a26	C	A	19: 7,802,181	R90L	probably damaging	Het
Slitrk5	T	C	14: 111,680,216	V424A	probably damaging	Het
Smarca2	G	T	19: 26,720,855	E89*	probably null	Het
Soga1	C	T	2: 157,022,856	G1144D	probably benign	Het
Stab2	T	A	10: 86,937,909	S853C	probably damaging	Het
Stk17b	A	T	1: 53,761,147		probably null	Het
Taar5	T	A	10: 23,971,547	I281N	possibly damaging	Het
Tarsl2	A	T	7: 65,658,935	E284D	probably damaging	Het
Tfr2	G	A	5: 137,586,925	V740I	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tmem145	A	G	7: 25,309,034	T302A	probably benign	Het
Tmem57	A	G	4: 134,828,133	I343T	probably benign	Het
Trpa1	G	T	1: 14,875,861	H1015Q	probably benign	Het
Tspan8	A	G	10: 115,817,629	Y10C	possibly damaging	Het
Ttll7	A	G	3: 146,894,469	N44S	probably damaging	Het
Uba7	T	C	9: 107,979,839		probably null	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr5	C	A	15: 38,009,668	A1022S	probably benign	Het
Usf1	T	G	1: 171,415,763	I36S	probably damaging	Het
Vmn1r181	A	T	7: 23,984,365	D85V	probably damaging	Het
Vmn1r3	A	T	4: 3,185,009	Y99*	probably null	Het
Vmn1r72	T	C	7: 11,670,373	I49M	possibly damaging	Het
Vmn2r99	A	G	17: 19,362,135	M1V	probably null	Het
Vsig10	T	A	5: 117,343,975	V410E	probably damaging	Het
Zc3h7b	A	G	15: 81,779,133	Y442C	probably damaging	Het
Zfyve26	G	T	12: 79,280,385	Y730*	probably null	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATGCCCAGCCTAAACTTTC -3'
(R):5'- GTGCTATAAGACTGGTCTCTCC -3'

Sequencing Primer
(F):5'- GCCCAGCCTAAACTTTCCTCTTTG -3'
(R):5'- AAGTTCTGCTCATACCTCTGGGAG -3'

Posted On

2016-06-06