Incidental Mutation 'R4999:Rufy3'
ID389716
Institutional Source Beutler Lab
Gene Symbol Rufy3
Ensembl Gene ENSMUSG00000029291
Gene NameRUN and FYVE domain containing 3
SynonymsRpipx, D5Bwg0860e, 2810428M05Rik, 6330416M07Rik
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88565040-88651392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88637226 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 387 (M387K)
Ref Sequence ENSEMBL: ENSMUSP00000143115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031229] [ENSMUST00000196686] [ENSMUST00000196894] [ENSMUST00000198965] [ENSMUST00000199312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031229
AA Change: M369K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031229
Gene: ENSMUSG00000029291
AA Change: M369K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 163 225 8.08e-23 SMART
coiled coil region 267 329 N/A INTRINSIC
coiled coil region 357 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196686
AA Change: M387K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143209
Gene: ENSMUSG00000029291
AA Change: M387K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196894
AA Change: M419K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143770
Gene: ENSMUSG00000029291
AA Change: M419K

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 8.08e-23 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198965
AA Change: M419K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143302
Gene: ENSMUSG00000029291
AA Change: M419K

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 2.8e-25 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 555 N/A INTRINSIC
FYVE 597 662 2.9e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199312
AA Change: M387K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143115
Gene: ENSMUSG00000029291
AA Change: M387K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RPIP8, UNC-14, and NESCA domain-containing protein that is required for maintenance of neuronal polarity. In addition, it has been implicated in mediation of gastric cancer cell migration and invasion via interaction with P21-activated kinase-1, which promotes its expression. The encoded protein localizes to F-actin-enriched invadopodia to induce formation of protrusions, thereby facilitating cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: The gene product is involved in regulating neuronal polarity and axon growth. Homozygous KO leads to loss of neuronal polarity and causes neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Rufy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Rufy3 APN 5 88621350 missense probably damaging 0.96
IGL01964:Rufy3 APN 5 88615070 missense probably damaging 1.00
IGL02537:Rufy3 APN 5 88640662 utr 3 prime probably benign
R0111:Rufy3 UTSW 5 88630584 missense probably damaging 1.00
R0552:Rufy3 UTSW 5 88584270 missense possibly damaging 0.79
R1441:Rufy3 UTSW 5 88632515 missense probably damaging 0.97
R1565:Rufy3 UTSW 5 88640632 missense probably damaging 1.00
R2507:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R2508:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R3707:Rufy3 UTSW 5 88643032 missense probably benign 0.28
R4907:Rufy3 UTSW 5 88584192 missense possibly damaging 0.95
R5134:Rufy3 UTSW 5 88645567 missense probably benign 0.01
R5420:Rufy3 UTSW 5 88640659 makesense probably null
R5482:Rufy3 UTSW 5 88637332 frame shift probably null
R6029:Rufy3 UTSW 5 88627255 missense probably damaging 1.00
R6254:Rufy3 UTSW 5 88584309 missense probably benign 0.01
R6444:Rufy3 UTSW 5 88637307 missense probably damaging 1.00
R7219:Rufy3 UTSW 5 88649856 missense probably benign 0.22
R7256:Rufy3 UTSW 5 88614947 missense possibly damaging 0.91
R7327:Rufy3 UTSW 5 88642952 missense probably damaging 0.99
R7352:Rufy3 UTSW 5 88637194 missense possibly damaging 0.92
R7484:Rufy3 UTSW 5 88598472 missense probably benign 0.01
R7645:Rufy3 UTSW 5 88640617 missense probably benign 0.01
R8043:Rufy3 UTSW 5 88642992 missense not run
X0066:Rufy3 UTSW 5 88617418 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCCAGATGCCTCTACTCTATCAG -3'
(R):5'- AGTCTACAGAAGAGGCGTGC -3'

Sequencing Primer
(F):5'- GATGCCTCTACTCTATCAGAAACAC -3'
(R):5'- TATGGGCAGCACCAGGAGTTC -3'
Posted On2016-06-06