Incidental Mutation 'R4999:Ccp110'
ID389737
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Namecentriolar coiled coil protein 110
Synonyms6330503K22Rik, CP110
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118712552-118737024 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 118730012 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 73 (E73*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000106557]
Predicted Effect probably null
Transcript: ENSMUST00000038650
AA Change: E873*
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904
AA Change: E873*

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106557
AA Change: E873*
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904
AA Change: E873*

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123178
AA Change: E709*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149056
Predicted Effect probably null
Transcript: ENSMUST00000208766
AA Change: E73*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118722424 missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118729997 missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118730723 missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118722684 missense probably benign
IGL01837:Ccp110 APN 7 118725461 critical splice donor site probably null
PIT4469001:Ccp110 UTSW 7 118722377 missense probably benign 0.06
R1217:Ccp110 UTSW 7 118729944 splice site probably benign
R1640:Ccp110 UTSW 7 118715528 splice site probably null
R1700:Ccp110 UTSW 7 118735313 missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118726024 unclassified probably null
R4737:Ccp110 UTSW 7 118724548 missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118725430 missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118725319 missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118722391 missense possibly damaging 0.85
R5212:Ccp110 UTSW 7 118729696 missense probably damaging 0.99
R5600:Ccp110 UTSW 7 118729725 critical splice donor site probably null
R6953:Ccp110 UTSW 7 118722421 missense possibly damaging 0.85
R6998:Ccp110 UTSW 7 118732897 missense possibly damaging 0.91
R7076:Ccp110 UTSW 7 118732405 missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118735271 missense probably benign 0.26
R7336:Ccp110 UTSW 7 118722210 missense probably damaging 0.99
R7343:Ccp110 UTSW 7 118724575 missense probably benign 0.03
R7866:Ccp110 UTSW 7 118723018 missense probably benign 0.07
R7949:Ccp110 UTSW 7 118723018 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCCAGGGTTAGAAATGTATTTC -3'
(R):5'- CCCTACACAGCTCAGTAGTG -3'

Sequencing Primer
(F):5'- CTCGTTGTTTAAACAGGGAAAACTGG -3'
(R):5'- CAGAAAGTCGTATGGGGT -3'
Posted On2016-06-06