Incidental Mutation 'R4999:Myo1e'
ID389746
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70353312 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 584 (I584N)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: I584N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: I584N

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214767
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGCACAATGAGGCTCAAC -3'
(R):5'- CTGAATGGAATGATATGGCTAGC -3'

Sequencing Primer
(F):5'- GAGGCTCAACATGACATTTGTTTCTG -3'
(R):5'- CCATTGGTTGGTTGACCT -3'
Posted On2016-06-06