Incidental Mutation 'R4999:Uba7'
ID389749
Institutional Source Beutler Lab
Gene Symbol Uba7
Ensembl Gene ENSMUSG00000032596
Gene Nameubiquitin-like modifier activating enzyme 7
Synonyms1300004C08Rik, Ube1l
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107975505-107984060 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 107979839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000048568] [ENSMUST00000175914] [ENSMUST00000177368] [ENSMUST00000177392]
Predicted Effect probably null
Transcript: ENSMUST00000035216
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048568
SMART Domains Protein: ENSMUSP00000040433
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 52 73 N/A INTRINSIC
Pfam:FAM212 146 201 1.7e-30 PFAM
low complexity region 228 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect probably benign
Transcript: ENSMUST00000175914
SMART Domains Protein: ENSMUSP00000134980
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177392
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Uba7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Uba7 APN 9 107979111 missense probably benign 0.31
IGL01696:Uba7 APN 9 107977348 missense probably damaging 1.00
IGL02137:Uba7 APN 9 107979753 splice site probably benign
IGL02272:Uba7 APN 9 107976153 missense probably benign 0.01
IGL02287:Uba7 APN 9 107978227 missense probably benign 0.10
IGL02430:Uba7 APN 9 107979468 splice site probably benign
IGL02552:Uba7 APN 9 107981390 missense probably benign 0.00
IGL02820:Uba7 APN 9 107981516 missense probably benign 0.01
IGL03234:Uba7 APN 9 107976400 missense probably damaging 0.97
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0717:Uba7 UTSW 9 107977217 missense probably benign 0.44
R2108:Uba7 UTSW 9 107979288 missense probably benign
R2253:Uba7 UTSW 9 107976364 missense probably benign 0.26
R4239:Uba7 UTSW 9 107976802 critical splice donor site probably null
R4528:Uba7 UTSW 9 107983903 missense possibly damaging 0.79
R4735:Uba7 UTSW 9 107976916 missense possibly damaging 0.94
R4736:Uba7 UTSW 9 107980165 missense probably benign 0.00
R4751:Uba7 UTSW 9 107979805 missense possibly damaging 0.66
R4937:Uba7 UTSW 9 107978991 missense possibly damaging 0.95
R5020:Uba7 UTSW 9 107978914 missense probably benign
R5157:Uba7 UTSW 9 107980047 missense probably benign 0.04
R5214:Uba7 UTSW 9 107977514 intron probably benign
R5339:Uba7 UTSW 9 107978866 missense probably damaging 1.00
R5990:Uba7 UTSW 9 107981234 missense probably damaging 0.96
R6092:Uba7 UTSW 9 107983160 missense possibly damaging 0.96
R6110:Uba7 UTSW 9 107978939 missense probably benign 0.25
R6363:Uba7 UTSW 9 107980183 critical splice donor site probably null
R6495:Uba7 UTSW 9 107977014 nonsense probably null
R6644:Uba7 UTSW 9 107981472 missense possibly damaging 0.55
R7032:Uba7 UTSW 9 107976172 missense possibly damaging 0.83
R7095:Uba7 UTSW 9 107983339 missense probably benign 0.01
X0024:Uba7 UTSW 9 107975945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTGGCAAGACTGTGTG -3'
(R):5'- ATGCATGTCCTACAGCCAGG -3'

Sequencing Primer
(F):5'- CAAGACTGTGTGGTGTGGGC -3'
(R):5'- ATGTCCTACAGCCAGGCAGAG -3'
Posted On2016-06-06