Incidental Mutation 'R4999:Olfr191'
ID389773
Institutional Source Beutler Lab
Gene Symbol Olfr191
Ensembl Gene ENSMUSG00000094539
Gene Nameolfactory receptor 191
SynonymsGA_x54KRFPKG5P-55314632-55313703, MOR183-5P
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59082829-59089822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59086402 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 27 (L27Q)
Ref Sequence ENSEMBL: ENSMUSP00000150473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078517] [ENSMUST00000205471] [ENSMUST00000215647]
Predicted Effect probably damaging
Transcript: ENSMUST00000078517
AA Change: L27Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077604
Gene: ENSMUSG00000094539
AA Change: L27Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-47 PFAM
Pfam:7tm_1 41 290 6.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205471
AA Change: L27Q
Predicted Effect probably damaging
Transcript: ENSMUST00000215647
AA Change: L27Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Olfr191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr191 APN 16 59086393 missense possibly damaging 0.86
IGL01553:Olfr191 APN 16 59086322 missense probably benign 0.35
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R1367:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R1631:Olfr191 UTSW 16 59086045 missense probably benign
R1660:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R2166:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2167:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2168:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2191:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R3836:Olfr191 UTSW 16 59086223 missense possibly damaging 0.61
R5386:Olfr191 UTSW 16 59085890 missense probably benign
R5589:Olfr191 UTSW 16 59085971 missense probably benign 0.03
R5590:Olfr191 UTSW 16 59085997 missense probably benign 0.06
R5609:Olfr191 UTSW 16 59086076 missense possibly damaging 0.96
R5965:Olfr191 UTSW 16 59086303 missense probably damaging 1.00
R5989:Olfr191 UTSW 16 59086334 missense probably benign 0.00
R6049:Olfr191 UTSW 16 59086146 nonsense probably null
R6058:Olfr191 UTSW 16 59085910 missense probably damaging 0.99
R6058:Olfr191 UTSW 16 59086429 missense probably benign
R6250:Olfr191 UTSW 16 59085832 missense probably damaging 1.00
R6319:Olfr191 UTSW 16 59086021 missense probably benign 0.08
R6473:Olfr191 UTSW 16 59086043 missense probably benign 0.09
R6524:Olfr191 UTSW 16 59086277 missense possibly damaging 0.76
R6748:Olfr191 UTSW 16 59085890 missense probably benign
R6874:Olfr191 UTSW 16 59085949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTCCGTGGTTGCACTCACTAC -3'
(R):5'- GGCCAACCTGATAACTACAGAG -3'

Sequencing Primer
(F):5'- CGTGGTTGCACTCACTACAAATG -3'
(R):5'- GCCAACCTGATAACTACAGAGTTGTG -3'
Posted On2016-06-06