Incidental Mutation 'R5000:Hnrnpu'
ID389787
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5000 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 178329376 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: H794R
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: H794R

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150825
Predicted Effect probably benign
Transcript: ENSMUST00000161769
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162916
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect silent
Transcript: ENSMUST00000189450
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1136:Hnrnpu UTSW 1 178331225 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4408:Hnrnpu UTSW 1 178330803 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5307:Hnrnpu UTSW 1 178337312 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R6931:Hnrnpu UTSW 1 178331432 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
R7391:Hnrnpu UTSW 1 178337078 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTGAGGTTCTCTTACGATTCAC -3'
(R):5'- AACTAACCCTAAGTCTTGTGTTTCC -3'

Sequencing Primer
(F):5'- CTCTTACGATTCACTTTAAAACTGC -3'
(R):5'- AACCCTAAGTCTTGTGTTTCCTTTGG -3'
Posted On2016-06-06