Incidental Mutation 'R5000:Spo11'
ID389796
Institutional Source Beutler Lab
Gene Symbol Spo11
Ensembl Gene ENSMUSG00000005883
Gene NameSPO11 meiotic protein covalently bound to DSB
Synonyms
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5000 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172977700-172993576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172989400 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000104753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050442] [ENSMUST00000109125] [ENSMUST00000109126]
Predicted Effect probably damaging
Transcript: ENSMUST00000050442
AA Change: S293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059056
Gene: ENSMUSG00000005883
AA Change: S293P

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 6.3e-28 PFAM
Pfam:TP6A_N 107 170 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109125
AA Change: S255P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104753
Gene: ENSMUSG00000005883
AA Change: S255P

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1e-30 PFAM
Pfam:TP6A_N 66 133 3.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109126
AA Change: S268P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104754
Gene: ENSMUSG00000005883
AA Change: S268P

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1.1e-30 PFAM
Pfam:TP6A_N 102 146 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156471
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Mutant males exhibit loss of spermatocytes in early prophase, while mutant females exhibit oocyte loss soon after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Spo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Spo11 APN 2 172989032 critical splice donor site probably null
IGL02080:Spo11 APN 2 172989395 missense probably damaging 1.00
IGL02309:Spo11 APN 2 172979951 missense probably damaging 0.98
R3027:Spo11 UTSW 2 172985943 missense probably damaging 0.99
R4031:Spo11 UTSW 2 172986832 splice site probably benign
R5443:Spo11 UTSW 2 172989359 splice site probably benign
R7185:Spo11 UTSW 2 172982192 intron probably null
R7486:Spo11 UTSW 2 172984077 missense probably benign 0.01
R7565:Spo11 UTSW 2 172992071 missense possibly damaging 0.65
X0061:Spo11 UTSW 2 172993050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTTAGAGCATTTGCATAG -3'
(R):5'- TTGCTGCTGATGCTGAGAGC -3'

Sequencing Primer
(F):5'- CATGCATGACGTCCTAGGTTCAATG -3'
(R):5'- CGGGGCTCACACCACTGAG -3'
Posted On2016-06-06