Mutagenetix > Incidental Mutation

Incidental Mutation 'R5000:Sel1l3'

389806

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

042594-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5000 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53200434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 72 (T72M)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

AlphaFold

Q80TS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000031090
AA Change: T72M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: T72M

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199919

Meta Mutation Damage Score

0.3548

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

98% (97/99)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,556,521	F11Y	probably benign	Het
Abca5	A	G	11: 110,310,224	L450P	probably damaging	Het
Abi1	T	A	2: 22,950,199	R357W	probably damaging	Het
Acot7	G	A	4: 152,186,363	G55R	probably benign	Het
Aicda	G	A	6: 122,561,867	V14I	probably damaging	Het
Anxa4	G	T	6: 86,765,784		probably benign	Het
Apobr	T	A	7: 126,586,557	D413E	possibly damaging	Het
Ash1l	T	C	3: 89,058,634	Y2448H	probably damaging	Het
Atf7ip	A	G	6: 136,582,428	E749G	probably damaging	Het
Atp8b3	A	T	10: 80,521,842	N1114K	possibly damaging	Het
Bdnf	C	A	2: 109,723,648	N122K	probably benign	Het
Boc	A	T	16: 44,490,154	I801N	probably damaging	Het
Brap	A	T	5: 121,662,026	K37*	probably null	Het
Ccar1	C	T	10: 62,751,005	E885K	unknown	Het
Ccdc103	A	G	11: 102,884,106	N177S	probably benign	Het
Ccdc116	G	A	16: 17,141,793	P344L	possibly damaging	Het
Cdca5	T	C	19: 6,085,433	S28P	possibly damaging	Het
Ceacam20	T	C	7: 19,965,528	I14T	probably damaging	Het
Chrnb1	A	T	11: 69,787,032	V298E	probably damaging	Het
Cnksr3	G	A	10: 7,126,746	Q149*	probably null	Het
Csnk1a1	T	C	18: 61,578,769	F97L	probably damaging	Het
Dag1	A	T	9: 108,208,017	S642T	probably benign	Het
Dedd2	A	G	7: 25,203,643	V297A	possibly damaging	Het
Dhcr7	C	T	7: 143,841,323	T189M	possibly damaging	Het
Dlgap1	T	C	17: 70,766,058	S691P	probably damaging	Het
Dmgdh	A	C	13: 93,688,538	H123P	probably damaging	Het
Dnah6	C	T	6: 73,144,815	V1395I	probably benign	Het
Dnah7a	T	C	1: 53,567,042	Y1273C	probably damaging	Het
Dnah7b	T	A	1: 46,099,503	L235*	probably null	Het
Elac2	T	C	11: 64,985,553	F3L	probably benign	Het
Elovl7	A	T	13: 108,274,381	K163N	probably benign	Het
Epg5	T	C	18: 77,954,161	V413A	probably benign	Het
Espl1	T	A	15: 102,298,551	L150Q	probably damaging	Het
F2rl3	T	A	8: 72,762,679	L178Q	probably damaging	Het
Fam120a	T	C	13: 48,897,667	E754G	probably damaging	Het
Fam53b	T	C	7: 132,716,001	N304S	probably benign	Het
Fbxo41	T	C	6: 85,483,919	E269G	probably damaging	Het
Fcrla	T	C	1: 170,922,390	T4A	probably benign	Het
Frmpd1	A	T	4: 45,261,931		probably null	Het
Gm9376	A	G	14: 118,267,290	M45V	probably benign	Het
Gpr68	G	A	12: 100,878,337	A316V	probably benign	Het
Hmgcl	G	A	4: 135,962,200	C323Y	probably benign	Het
Hnrnpu	T	C	1: 178,329,376		probably benign	Het
Ier2	T	A	8: 84,662,724	I10F	probably damaging	Het
Ip6k1	C	T	9: 108,045,599	Q234*	probably null	Het
Llgl2	T	C	11: 115,844,902	V108A	probably benign	Het
Lrfn3	T	C	7: 30,360,380	N140S	possibly damaging	Het
Lrig1	T	A	6: 94,611,449	H573L	probably damaging	Het
Lrrk2	T	A	15: 91,749,878	W1393R	probably damaging	Het
Mrc1	T	A	2: 14,244,189	Y179N	probably damaging	Het
Mtfr1	C	T	3: 19,211,579	L93F	probably damaging	Het
Muc19	T	C	15: 91,873,231		noncoding transcript	Het
Ndst2	C	T	14: 20,724,907		probably null	Het
Nmd3	A	T	3: 69,717,402		probably benign	Het
Nsd3	A	G	8: 25,682,577	Y784C	probably damaging	Het
Olfr1197	A	T	2: 88,729,566	I11N	probably damaging	Het
Olfr1352	G	A	10: 78,984,680	V297I	probably benign	Het
Papln	A	G	12: 83,774,889	Y297C	probably damaging	Het
Pdhx	T	C	2: 103,041,040		probably null	Het
Pdpk1	T	C	17: 24,111,045	T6A	possibly damaging	Het
Prcp	T	C	7: 92,919,160	W267R	probably damaging	Het
Prg2	T	C	2: 84,982,023	S26P	probably benign	Het
Psg26	A	T	7: 18,480,132	Y202N	possibly damaging	Het
Psrc1	T	C	3: 108,380,523		probably benign	Het
Rap1gds1	A	T	3: 138,956,250	M366K	probably damaging	Het
Robo4	G	T	9: 37,408,368	R527L	probably benign	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	A	G	5: 12,448,038	T4A	probably benign	Het
Shroom1	A	T	11: 53,467,117		probably benign	Het
Slc25a19	T	C	11: 115,616,671		probably null	Het
Snx29	A	C	16: 11,403,507	I266L	probably damaging	Het
Spo11	T	C	2: 172,989,400	S255P	probably damaging	Het
Spock3	T	C	8: 63,245,124	V167A	possibly damaging	Het
Tmc7	A	G	7: 118,558,854		probably null	Het
Tmtc4	A	G	14: 122,933,331	V509A	possibly damaging	Het
Trim24	A	G	6: 37,958,612	D880G	probably benign	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr4	T	A	4: 139,436,169	C2627S	probably damaging	Het
Unc5d	A	T	8: 28,715,747	M512K	possibly damaging	Het
Usp18	A	G	6: 121,252,520	R33G	possibly damaging	Het
Utp23	T	A	15: 51,882,173	V23D	probably damaging	Het
Wdr17	T	A	8: 54,665,126	M512L	possibly damaging	Het
Wdr64	T	A	1: 175,726,375		probably null	Het
Zbtb6	T	C	2: 37,429,239	T226A	probably benign	Het
Zc3hc1	T	A	6: 30,375,988	H191L	possibly damaging	Het
Zdhhc4	C	A	5: 143,324,933	C48F	probably damaging	Het
Zfp335	T	A	2: 164,894,668	T1016S	probably benign	Het
Zfp583	A	G	7: 6,325,474	Y39H	probably damaging	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R3434:Sel1l3	UTSW	5	53117090	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53131842	missense	probably damaging	1.00
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53186009	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53172574	missense	probably benign	0.03
R7200:Sel1l3	UTSW	5	53144109	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53135823	nonsense	probably null
R8788:Sel1l3	UTSW	5	53174806	nonsense	probably null
R8988:Sel1l3	UTSW	5	53123429	missense	probably damaging	0.96
R9111:Sel1l3	UTSW	5	53121871	splice site	probably benign
R9153:Sel1l3	UTSW	5	53135846	missense	probably benign	0.26
R9269:Sel1l3	UTSW	5	53154286	missense	probably damaging	1.00
R9399:Sel1l3	UTSW	5	53108144	missense	probably benign
R9455:Sel1l3	UTSW	5	53131815	missense	probably damaging	0.99
R9630:Sel1l3	UTSW	5	53184775	missense	possibly damaging	0.49
R9793:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
R9795:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTTCTGAACTCGGAGGAGAC -3'
(R):5'- GCATGGCCCAGTCTTCATTTG -3'

Sequencing Primer
(F):5'- ACTCGGAGGAGACAACCGC -3'
(R):5'- CCCAGTCTAATGGTCGTGC -3'

Posted On

2016-06-06