Incidental Mutation 'R5000:Chrnb1'
ID389844
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Namecholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
SynonymsAChR beta, Acrb, Achr-2
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5000 (G1)
Quality Score223
Status Validated
Chromosome11
Chromosomal Location69784036-69795943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69787032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 298 (V298E)
Ref Sequence ENSEMBL: ENSMUSP00000047270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045971] [ENSMUST00000108639]
Predicted Effect probably damaging
Transcript: ENSMUST00000045971
AA Change: V298E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189
AA Change: V298E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108639
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Meta Mutation Damage Score 0.4897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69793916 missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69795019 unclassified probably benign
IGL01983:Chrnb1 APN 11 69795729 missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69793455 unclassified probably benign
IGL02507:Chrnb1 APN 11 69785090 missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69795680 missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69785109 missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69784757 missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69785762 missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69793584 missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69792737 missense possibly damaging 0.81
R2233:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R2234:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69792916 unclassified probably benign
R4183:Chrnb1 UTSW 11 69787096 missense possibly damaging 0.50
R4425:Chrnb1 UTSW 11 69786947 missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69795675 missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69793978 missense probably damaging 1.00
R5378:Chrnb1 UTSW 11 69785181 missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69794153 missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69795650 missense probably benign 0.30
R5574:Chrnb1 UTSW 11 69793683 unclassified probably benign
R5890:Chrnb1 UTSW 11 69792729 missense possibly damaging 0.94
R5973:Chrnb1 UTSW 11 69795845 unclassified probably benign
R6056:Chrnb1 UTSW 11 69786939 missense probably damaging 1.00
R7466:Chrnb1 UTSW 11 69784650 missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69792873 missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69787024 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATGCAGAGAGCTCTCCTACC -3'
(R):5'- AGAGATGTCCTTCTGGTAAAGACG -3'

Sequencing Primer
(F):5'- TACCTGGCGGACCCAAAAGG -3'
(R):5'- GTCCTTCTGGTAAAGACGAATCC -3'
Posted On2016-06-06