Incidental Mutation 'R5000:Selenoo'
ID389859
Institutional Source Beutler Lab
Gene Symbol Selenoo
Ensembl Gene ENSMUSG00000035757
Gene Nameselenoprotein O
SynonymsSelo, 1300018J18Rik
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5000 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89089084-89100340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89094184 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 270 (R270H)
Ref Sequence ENSEMBL: ENSMUSP00000081020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700]
Predicted Effect probably damaging
Transcript: ENSMUST00000082439
AA Change: R270H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757
AA Change: R270H

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130700
AA Change: V251M
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757
AA Change: V251M

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164717
Meta Mutation Damage Score 0.2463 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: This gene encodes a selenoprotein that is localized to the mitochondria. It is the largest mammalian selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The exact function of this selenoprotein is not known, but it is thought to have redox activity. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Selenoo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Selenoo APN 15 89095672 missense probably damaging 1.00
IGL01922:Selenoo APN 15 89099649 missense probably benign 0.06
IGL02103:Selenoo APN 15 89099970 missense probably damaging 1.00
R0655:Selenoo UTSW 15 89095655 missense probably damaging 1.00
R0960:Selenoo UTSW 15 89096754 missense probably benign 0.08
R1610:Selenoo UTSW 15 89099916 missense probably benign
R2152:Selenoo UTSW 15 89099282 missense probably benign 0.01
R4177:Selenoo UTSW 15 89099459 unclassified probably benign
R4588:Selenoo UTSW 15 89096718 missense probably benign 0.01
R4622:Selenoo UTSW 15 89095707 nonsense probably null
R4731:Selenoo UTSW 15 89099328 missense probably benign 0.00
R4926:Selenoo UTSW 15 89099678 missense probably damaging 0.98
R4934:Selenoo UTSW 15 89098767 missense probably damaging 0.98
R4999:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5033:Selenoo UTSW 15 89092766 missense probably damaging 1.00
R5120:Selenoo UTSW 15 89094305 missense possibly damaging 0.79
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R7238:Selenoo UTSW 15 89089224 missense probably benign 0.15
R7287:Selenoo UTSW 15 89098700 missense probably benign 0.01
R7378:Selenoo UTSW 15 89089478 missense probably benign 0.07
R7818:Selenoo UTSW 15 89096816 missense probably damaging 1.00
R8058:Selenoo UTSW 15 89092739 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTGAGTCTCCAGCATCTG -3'
(R):5'- AAGACACCAGATGGCCAGTG -3'

Sequencing Primer
(F):5'- ACTCAGATCTGGCAATGCTCTGG -3'
(R):5'- AGTGGAGAACCTCTGCCTAC -3'
Posted On2016-06-06