Incidental Mutation 'R5000:Lrrk2'
ID 389860
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 042594-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975
Essential gene? Possibly essential (E-score: 0.533) question?
Stock # R5000 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91749878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1393 (W1393R)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: W1393R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: W1393R

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Meta Mutation Damage Score 0.9336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91723162 missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
R9605:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91812324 missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91787048 missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91765681 missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91750279 nonsense probably null
R9728:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91811026 missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCGAATGAAGCTCATGATTGTG -3'
(R):5'- TGAGAACCACGATTAGCTGCC -3'

Sequencing Primer
(F):5'- GCTCATGATTGTGGGAAATACG -3'
(R):5'- AAGCAATTTAGACCTCTCTGCTGGG -3'
Posted On 2016-06-06