Mutagenetix > Incidental Mutation

Incidental Mutation 'R5000:Espl1'

389862

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

042594-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5000 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102298551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 150 (L150Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: L150Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: L150Q

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: L150Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

probably damaging
Transcript: ENSMUST00000230212
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Meta Mutation Damage Score

0.1088

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

98% (97/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,556,521	F11Y	probably benign	Het
Abca5	A	G	11: 110,310,224	L450P	probably damaging	Het
Abi1	T	A	2: 22,950,199	R357W	probably damaging	Het
Acot7	G	A	4: 152,186,363	G55R	probably benign	Het
Aicda	G	A	6: 122,561,867	V14I	probably damaging	Het
Anxa4	G	T	6: 86,765,784		probably benign	Het
Apobr	T	A	7: 126,586,557	D413E	possibly damaging	Het
Ash1l	T	C	3: 89,058,634	Y2448H	probably damaging	Het
Atf7ip	A	G	6: 136,582,428	E749G	probably damaging	Het
Atp8b3	A	T	10: 80,521,842	N1114K	possibly damaging	Het
Bdnf	C	A	2: 109,723,648	N122K	probably benign	Het
Boc	A	T	16: 44,490,154	I801N	probably damaging	Het
Brap	A	T	5: 121,662,026	K37*	probably null	Het
Ccar1	C	T	10: 62,751,005	E885K	unknown	Het
Ccdc103	A	G	11: 102,884,106	N177S	probably benign	Het
Ccdc116	G	A	16: 17,141,793	P344L	possibly damaging	Het
Cdca5	T	C	19: 6,085,433	S28P	possibly damaging	Het
Ceacam20	T	C	7: 19,965,528	I14T	probably damaging	Het
Chrnb1	A	T	11: 69,787,032	V298E	probably damaging	Het
Cnksr3	G	A	10: 7,126,746	Q149*	probably null	Het
Csnk1a1	T	C	18: 61,578,769	F97L	probably damaging	Het
Dag1	A	T	9: 108,208,017	S642T	probably benign	Het
Dedd2	A	G	7: 25,203,643	V297A	possibly damaging	Het
Dhcr7	C	T	7: 143,841,323	T189M	possibly damaging	Het
Dlgap1	T	C	17: 70,766,058	S691P	probably damaging	Het
Dmgdh	A	C	13: 93,688,538	H123P	probably damaging	Het
Dnah6	C	T	6: 73,144,815	V1395I	probably benign	Het
Dnah7a	T	C	1: 53,567,042	Y1273C	probably damaging	Het
Dnah7b	T	A	1: 46,099,503	L235*	probably null	Het
Elac2	T	C	11: 64,985,553	F3L	probably benign	Het
Elovl7	A	T	13: 108,274,381	K163N	probably benign	Het
Epg5	T	C	18: 77,954,161	V413A	probably benign	Het
F2rl3	T	A	8: 72,762,679	L178Q	probably damaging	Het
Fam120a	T	C	13: 48,897,667	E754G	probably damaging	Het
Fam53b	T	C	7: 132,716,001	N304S	probably benign	Het
Fbxo41	T	C	6: 85,483,919	E269G	probably damaging	Het
Fcrla	T	C	1: 170,922,390	T4A	probably benign	Het
Frmpd1	A	T	4: 45,261,931		probably null	Het
Gm9376	A	G	14: 118,267,290	M45V	probably benign	Het
Gpr68	G	A	12: 100,878,337	A316V	probably benign	Het
Hmgcl	G	A	4: 135,962,200	C323Y	probably benign	Het
Hnrnpu	T	C	1: 178,329,376		probably benign	Het
Ier2	T	A	8: 84,662,724	I10F	probably damaging	Het
Ip6k1	C	T	9: 108,045,599	Q234*	probably null	Het
Llgl2	T	C	11: 115,844,902	V108A	probably benign	Het
Lrfn3	T	C	7: 30,360,380	N140S	possibly damaging	Het
Lrig1	T	A	6: 94,611,449	H573L	probably damaging	Het
Lrrk2	T	A	15: 91,749,878	W1393R	probably damaging	Het
Mrc1	T	A	2: 14,244,189	Y179N	probably damaging	Het
Mtfr1	C	T	3: 19,211,579	L93F	probably damaging	Het
Muc19	T	C	15: 91,873,231		noncoding transcript	Het
Ndst2	C	T	14: 20,724,907		probably null	Het
Nmd3	A	T	3: 69,717,402		probably benign	Het
Nsd3	A	G	8: 25,682,577	Y784C	probably damaging	Het
Olfr1197	A	T	2: 88,729,566	I11N	probably damaging	Het
Olfr1352	G	A	10: 78,984,680	V297I	probably benign	Het
Papln	A	G	12: 83,774,889	Y297C	probably damaging	Het
Pdhx	T	C	2: 103,041,040		probably null	Het
Pdpk1	T	C	17: 24,111,045	T6A	possibly damaging	Het
Prcp	T	C	7: 92,919,160	W267R	probably damaging	Het
Prg2	T	C	2: 84,982,023	S26P	probably benign	Het
Psg26	A	T	7: 18,480,132	Y202N	possibly damaging	Het
Psrc1	T	C	3: 108,380,523		probably benign	Het
Rap1gds1	A	T	3: 138,956,250	M366K	probably damaging	Het
Robo4	G	T	9: 37,408,368	R527L	probably benign	Het
Sel1l3	G	A	5: 53,200,434	T72M	probably damaging	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	A	G	5: 12,448,038	T4A	probably benign	Het
Shroom1	A	T	11: 53,467,117		probably benign	Het
Slc25a19	T	C	11: 115,616,671		probably null	Het
Snx29	A	C	16: 11,403,507	I266L	probably damaging	Het
Spo11	T	C	2: 172,989,400	S255P	probably damaging	Het
Spock3	T	C	8: 63,245,124	V167A	possibly damaging	Het
Tmc7	A	G	7: 118,558,854		probably null	Het
Tmtc4	A	G	14: 122,933,331	V509A	possibly damaging	Het
Trim24	A	G	6: 37,958,612	D880G	probably benign	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr4	T	A	4: 139,436,169	C2627S	probably damaging	Het
Unc5d	A	T	8: 28,715,747	M512K	possibly damaging	Het
Usp18	A	G	6: 121,252,520	R33G	possibly damaging	Het
Utp23	T	A	15: 51,882,173	V23D	probably damaging	Het
Wdr17	T	A	8: 54,665,126	M512L	possibly damaging	Het
Wdr64	T	A	1: 175,726,375		probably null	Het
Zbtb6	T	C	2: 37,429,239	T226A	probably benign	Het
Zc3hc1	T	A	6: 30,375,988	H191L	possibly damaging	Het
Zdhhc4	C	A	5: 143,324,933	C48F	probably damaging	Het
Zfp335	T	A	2: 164,894,668	T1016S	probably benign	Het
Zfp583	A	G	7: 6,325,474	Y39H	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTGGACCTGGCAGAGC -3'
(R):5'- GCATCGTACAGCTGATAGGC -3'

Sequencing Primer
(F):5'- CAGAGCTGGCCTGTGATG -3'
(R):5'- CTGATAGGCGGCAACTAAACGAC -3'

Posted On

2016-06-06