Incidental Mutation 'R5000:Espl1'
ID 389862
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms SSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 042594-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5000 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102296266-102324357 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102298551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 150 (L150Q)
Ref Sequence ENSEMBL: ENSMUSP00000155074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: L150Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: L150Q

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: L150Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably damaging
Transcript: ENSMUST00000230212
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231104
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
R8752:Espl1 UTSW 15 102306324 missense probably damaging 1.00
R9160:Espl1 UTSW 15 102298518 missense probably damaging 1.00
R9310:Espl1 UTSW 15 102296850 critical splice donor site probably null
R9385:Espl1 UTSW 15 102298750 missense probably damaging 0.99
R9532:Espl1 UTSW 15 102319825 nonsense probably null
R9563:Espl1 UTSW 15 102319798 missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102319798 missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102320735 missense probably benign 0.43
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTGGACCTGGCAGAGC -3'
(R):5'- GCATCGTACAGCTGATAGGC -3'

Sequencing Primer
(F):5'- CAGAGCTGGCCTGTGATG -3'
(R):5'- CTGATAGGCGGCAACTAAACGAC -3'
Posted On 2016-06-06