Mutagenetix > Incidental Mutations

Incidental Mutation 'R5001:Atf7ip'

389904

Institutional Source

Beutler Lab

Gene Symbol

Atf7ip

Ensembl Gene

ENSMUSG00000030213

Gene Name

activating transcription factor 7 interacting protein

Synonyms

Mcaf1, 2610204M12Rik, AM, ATFa-associated Modulator

MMRRC Submission

042595-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R5001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136506167-136610862 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136561388 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 548 (C548R)

Ref Sequence

ENSEMBL: ENSMUSP00000140502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000185724] [ENSMUST00000186577] [ENSMUST00000186742] [ENSMUST00000187429] [ENSMUST00000189535] [ENSMUST00000203988]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032335
AA Change: C540R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: C540R

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	9.59e-5	PROSPERO
internal_repeat_1	143	164	9.59e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
Pfam:ATF7IP_BD	598	813	5.5e-62	PFAM
low complexity region	864	889	N/A	INTRINSIC
PDB:2RPQ\|B	974	1017	5e-7	PDB
low complexity region	1022	1036	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1168	1192	N/A	INTRINSIC
FN3	1194	1288	3.4e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185724
AA Change: C540R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140458
Gene: ENSMUSG00000030213
AA Change: C540R

Domain	Start	End	E-Value	Type
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186577

SMART Domains

Protein: ENSMUSP00000140121
Gene: ENSMUSG00000030213

Domain	Start	End	E-Value	Type
coiled coil region	71	101	N/A	INTRINSIC
low complexity region	106	116	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186742

Predicted Effect

probably damaging
Transcript: ENSMUST00000187429
AA Change: C548R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: C548R

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	8.96e-5	PROSPERO
internal_repeat_1	143	164	8.96e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
coiled coil region	666	696	N/A	INTRINSIC
low complexity region	701	711	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	774	803	N/A	INTRINSIC
low complexity region	864	889	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189535

Predicted Effect

unknown
Transcript: ENSMUST00000203178
AA Change: C182R

Predicted Effect

probably benign
Transcript: ENSMUST00000203988

SMART Domains

Protein: ENSMUSP00000145022
Gene: ENSMUSG00000030213

Domain	Start	End	E-Value	Type
Pfam:ATF7IP_BD	3	73	1.6e-26	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy3	G	A	12: 4,198,434	V499M	possibly damaging	Het
Aff4	T	C	11: 53,404,357	S795P	probably damaging	Het
Ank	G	A	15: 27,562,733	V176I	probably damaging	Het
Ankfn1	A	G	11: 89,441,442	I446T	possibly damaging	Het
Arhgap33	C	A	7: 30,533,016	S32I	possibly damaging	Het
Ascc3	T	A	10: 50,823,648	Y1856N	probably damaging	Het
Atf3	T	C	1: 191,177,275	T66A	probably benign	Het
Bag6	A	G	17: 35,145,176	T841A	probably damaging	Het
Bbof1	A	T	12: 84,426,856	Q320L	possibly damaging	Het
Bmp2k	A	T	5: 97,053,142	Q307L	probably damaging	Het
Btaf1	T	A	19: 36,986,652	N874K	possibly damaging	Het
Calr4	G	A	4: 109,238,982		probably null	Het
Camk1d	T	C	2: 5,313,101	I248V	possibly damaging	Het
Ccdc130	G	A	8: 84,258,675	P322S	probably benign	Het
Ccdc177	G	A	12: 80,757,386	R705C	unknown	Het
Cdk18	C	T	1: 132,118,849		probably null	Het
Cers4	A	G	8: 4,515,565	S4G	probably benign	Het
Cfap54	A	G	10: 92,964,534	V1604A	probably benign	Het
Chd8	C	T	14: 52,203,915	G907S	probably benign	Het
Cnksr3	G	A	10: 7,126,746	Q149*	probably null	Het
Cntd1	T	C	11: 101,285,731	V218A	possibly damaging	Het
Cog7	A	T	7: 121,949,886	V384E	probably damaging	Het
Col5a2	A	G	1: 45,502,898	V6A	unknown	Het
Col7a1	T	C	9: 108,965,078		probably null	Het
Cpsf6	T	A	10: 117,367,961	I29L	possibly damaging	Het
Cyp3a13	T	C	5: 137,898,916	T379A	probably benign	Het
Ddx46	T	C	13: 55,652,919	S296P	probably damaging	Het
Dmbt1	A	G	7: 131,050,012	D328G	probably damaging	Het
Dnah8	T	G	17: 30,787,185	L3692W	probably damaging	Het
Dnmt3l	A	C	10: 78,059,731	S368R	probably null	Het
Egfr	A	G	11: 16,904,434	K869E	probably damaging	Het
Ehd1	G	A	19: 6,297,694	M359I	probably benign	Het
F5	A	T	1: 164,195,570	T1566S	probably benign	Het
Fam207a	A	G	10: 77,490,016	V154A	probably benign	Het
Flrt2	T	C	12: 95,778,951	I21T	probably benign	Het
Galnt1	T	A	18: 24,271,755	I383K	probably benign	Het
Ghdc	G	T	11: 100,766,834	A523D	probably damaging	Het
Gm24022	A	G	12: 113,429,779		probably benign	Het
Golga3	T	C	5: 110,205,777	S934P	probably damaging	Het
Gpr135	T	A	12: 72,070,508	T162S	probably benign	Het
Gucd1	G	A	10: 75,517,202		probably null	Het
Hcrtr2	T	A	9: 76,230,604	I410F	probably benign	Het
Ick	T	C	9: 78,131,519	S17P	probably damaging	Het
Igkv6-15	T	C	6: 70,406,649	Y56C	probably damaging	Het
Il22ra1	A	T	4: 135,733,104	Y57F	probably damaging	Het
Irak4	A	G	15: 94,558,273	E247G	possibly damaging	Het
Kank3	T	C	17: 33,821,772	V13A	possibly damaging	Het
Klhl1	A	T	14: 96,136,610	S667T	probably damaging	Het
Klhl6	T	G	16: 19,946,991	*620C	probably null	Het
Lct	A	G	1: 128,308,241	L343P	probably damaging	Het
Lgr6	G	T	1: 134,990,632	P264T	probably benign	Het
Lilrb4a	T	A	10: 51,491,420		probably null	Het
Lin7a	G	T	10: 107,382,669	G25*	probably null	Het
Lmnb2	G	A	10: 80,918,112	T36M	probably damaging	Het
Manba	T	C	3: 135,567,630	F775S	probably benign	Het
March6	A	G	15: 31,465,322	V812A	probably damaging	Het
Megf6	T	A	4: 154,268,060	L1292H	probably damaging	Het
Myo18b	T	G	5: 112,761,340	Q1979P	probably damaging	Het
Myoz1	T	C	14: 20,653,701	M59V	probably damaging	Het
Naa35	T	C	13: 59,625,531	I100T	possibly damaging	Het
Nox4	A	T	7: 87,360,803	Y404F	probably damaging	Het
Ntn1	T	C	11: 68,260,532	Y441C	probably damaging	Het
Olfr1329	C	A	4: 118,917,243	V75F	probably damaging	Het
Olfr351	T	C	2: 36,860,070	T93A	probably benign	Het
Olfr984	G	A	9: 40,101,227	H88Y	probably benign	Het
Onecut3	A	G	10: 80,495,320	T105A	unknown	Het
Pabpc1l	A	G	2: 164,042,518	S392G	probably benign	Het
Pan3	T	A	5: 147,526,682		probably null	Het
Pcdha4	G	A	18: 36,954,948	S728N	probably benign	Het
Pds5a	T	C	5: 65,696,785	D38G	probably damaging	Het
Pgm2l1	A	G	7: 100,272,376	I605V	probably benign	Het
Phip	T	C	9: 82,896,019		probably null	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Ppp2r2a	A	T	14: 67,022,308	L313*	probably null	Het
Ppp4c	A	G	7: 126,787,537	F126S	probably damaging	Het
Ptger2	C	A	14: 44,989,367	R135S	probably damaging	Het
Rab11fip5	T	A	6: 85,347,806	E506D	probably damaging	Het
Rdh12	G	A	12: 79,212,742	G133R	probably damaging	Het
Rims2	A	T	15: 39,452,428	D610V	probably benign	Het
Saa1	T	A	7: 46,740,708	Y122F	probably damaging	Het
Sept10	A	T	10: 59,176,989	V269E	probably damaging	Het
Serpina3n	T	A	12: 104,408,739	D23E	probably benign	Het
Serpinb11	A	G	1: 107,376,868	K188E	possibly damaging	Het
Slc18a3	C	T	14: 32,463,779	V216M	possibly damaging	Het
Slc19a3	G	T	1: 83,022,620	N225K	probably benign	Het
Slc4a1	T	A	11: 102,351,503	I797F	probably benign	Het
Spic	A	G	10: 88,675,899	M165T	possibly damaging	Het
Timm44	A	T	8: 4,275,886	M1K	probably null	Het
Tmc6	A	G	11: 117,770,784	L572P	probably benign	Het
Tnc	G	A	4: 63,984,489	T1517I	probably damaging	Het
Tnc	G	A	4: 64,000,062	T1204M	probably benign	Het
Trip11	A	T	12: 101,884,910	L680*	probably null	Het
Trps1	T	A	15: 50,661,307	M887L	possibly damaging	Het
Tulp3	A	C	6: 128,325,068	V330G	probably damaging	Het
Upf1	A	G	8: 70,334,700	S835P	probably damaging	Het
Wdr64	A	G	1: 175,792,959		probably null	Het
Zbtb40	A	G	4: 136,996,150	L643P	probably damaging	Het
Zc3h18	A	T	8: 122,383,520	D36V	probably damaging	Het

Other mutations in Atf7ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Atf7ip	APN	6	136560681	missense	probably benign	0.00
IGL01483:Atf7ip	APN	6	136587459	missense	probably damaging	1.00
IGL02313:Atf7ip	APN	6	136606720	missense	probably damaging	0.99
IGL02319:Atf7ip	APN	6	136593118	missense	probably benign	0.01
IGL02547:Atf7ip	APN	6	136603276	splice site	probably benign
IGL02869:Atf7ip	APN	6	136606579	missense	probably damaging	0.99
IGL02895:Atf7ip	APN	6	136560688	missense	probably damaging	0.99
IGL02967:Atf7ip	APN	6	136606727	missense	probably damaging	0.98
IGL03026:Atf7ip	APN	6	136605382	missense	possibly damaging	0.79
R0024:Atf7ip	UTSW	6	136599820	splice site	probably benign
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0325:Atf7ip	UTSW	6	136560989	missense	possibly damaging	0.86
R0331:Atf7ip	UTSW	6	136561163	missense	possibly damaging	0.94
R0415:Atf7ip	UTSW	6	136560012	missense	possibly damaging	0.92
R0490:Atf7ip	UTSW	6	136609192	unclassified	probably benign
R0526:Atf7ip	UTSW	6	136559805	missense	probably damaging	1.00
R1503:Atf7ip	UTSW	6	136606867	missense	probably damaging	0.96
R1663:Atf7ip	UTSW	6	136603324	missense	possibly damaging	0.93
R1793:Atf7ip	UTSW	6	136609219	unclassified	probably benign
R1822:Atf7ip	UTSW	6	136587260	missense	probably benign	0.11
R1873:Atf7ip	UTSW	6	136559888	missense	probably damaging	1.00
R1937:Atf7ip	UTSW	6	136560780	missense	probably benign	0.41
R2059:Atf7ip	UTSW	6	136609348	unclassified	probably benign
R2134:Atf7ip	UTSW	6	136605487	missense	possibly damaging	0.80
R2679:Atf7ip	UTSW	6	136566651	missense	possibly damaging	0.62
R3430:Atf7ip	UTSW	6	136575324	unclassified	probably benign
R3755:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3756:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3890:Atf7ip	UTSW	6	136587045	missense	possibly damaging	0.48
R4190:Atf7ip	UTSW	6	136587501	missense	probably damaging	1.00
R4494:Atf7ip	UTSW	6	136563749	splice site	probably null
R4588:Atf7ip	UTSW	6	136599694	missense	probably benign
R4618:Atf7ip	UTSW	6	136565106	missense	probably damaging	1.00
R4705:Atf7ip	UTSW	6	136561194	missense	probably damaging	1.00
R4838:Atf7ip	UTSW	6	136596491	missense	probably benign	0.06
R4922:Atf7ip	UTSW	6	136560041	missense	possibly damaging	0.91
R4956:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4957:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4958:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R5000:Atf7ip	UTSW	6	136582428	missense	probably damaging	1.00
R5075:Atf7ip	UTSW	6	136560234	missense	probably benign
R5279:Atf7ip	UTSW	6	136603379	nonsense	probably null
R5445:Atf7ip	UTSW	6	136587257	missense	probably damaging	1.00
R5844:Atf7ip	UTSW	6	136606814	missense	probably damaging	1.00
R5850:Atf7ip	UTSW	6	136566787	critical splice donor site	probably null
R5891:Atf7ip	UTSW	6	136559977	missense	possibly damaging	0.64
R5987:Atf7ip	UTSW	6	136571502	missense	probably damaging	1.00
R6168:Atf7ip	UTSW	6	136559819	missense	probably damaging	1.00
R6726:Atf7ip	UTSW	6	136582391	missense	probably damaging	1.00
R6880:Atf7ip	UTSW	6	136561040	missense	probably damaging	1.00
R6924:Atf7ip	UTSW	6	136559757	splice site	probably null
R7075:Atf7ip	UTSW	6	136596515	critical splice donor site	probably null
R7308:Atf7ip	UTSW	6	136565089	missense	probably benign	0.01
R7365:Atf7ip	UTSW	6	136560710	missense	probably benign
R7556:Atf7ip	UTSW	6	136561241	missense	probably damaging	0.99
R7812:Atf7ip	UTSW	6	136603417	missense	probably damaging	0.96
R7973:Atf7ip	UTSW	6	136561064	nonsense	probably null
R8032:Atf7ip	UTSW	6	136565112	missense	probably benign	0.00
R8203:Atf7ip	UTSW	6	136606783	missense	probably damaging	0.99
R8274:Atf7ip	UTSW	6	136560990	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCGAGGATGAACTCAGTTGC -3'
(R):5'- TACCCATGGAGCCAAAGTTAAC -3'

Sequencing Primer
(F):5'- CCGAGGATGAACTCAGTTGCTTTTC -3'
(R):5'- GCCAAAGTTAACTTTCAACTCCTTGG -3'

Posted On

2016-06-06