Incidental Mutation 'R5001:Dmbt1'
ID389912
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 042595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5001 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131050012 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 328 (D328G)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: D213G
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: D213G

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: D224G
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: D328G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 G A 12: 4,198,434 V499M possibly damaging Het
Aff4 T C 11: 53,404,357 S795P probably damaging Het
Ank G A 15: 27,562,733 V176I probably damaging Het
Ankfn1 A G 11: 89,441,442 I446T possibly damaging Het
Arhgap33 C A 7: 30,533,016 S32I possibly damaging Het
Ascc3 T A 10: 50,823,648 Y1856N probably damaging Het
Atf3 T C 1: 191,177,275 T66A probably benign Het
Atf7ip T C 6: 136,561,388 C548R probably damaging Het
Bag6 A G 17: 35,145,176 T841A probably damaging Het
Bbof1 A T 12: 84,426,856 Q320L possibly damaging Het
Bmp2k A T 5: 97,053,142 Q307L probably damaging Het
Btaf1 T A 19: 36,986,652 N874K possibly damaging Het
Calr4 G A 4: 109,238,982 probably null Het
Camk1d T C 2: 5,313,101 I248V possibly damaging Het
Ccdc130 G A 8: 84,258,675 P322S probably benign Het
Ccdc177 G A 12: 80,757,386 R705C unknown Het
Cdk18 C T 1: 132,118,849 probably null Het
Cers4 A G 8: 4,515,565 S4G probably benign Het
Cfap54 A G 10: 92,964,534 V1604A probably benign Het
Chd8 C T 14: 52,203,915 G907S probably benign Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Cntd1 T C 11: 101,285,731 V218A possibly damaging Het
Cog7 A T 7: 121,949,886 V384E probably damaging Het
Col5a2 A G 1: 45,502,898 V6A unknown Het
Col7a1 T C 9: 108,965,078 probably null Het
Cpsf6 T A 10: 117,367,961 I29L possibly damaging Het
Cyp3a13 T C 5: 137,898,916 T379A probably benign Het
Ddx46 T C 13: 55,652,919 S296P probably damaging Het
Dnah8 T G 17: 30,787,185 L3692W probably damaging Het
Dnmt3l A C 10: 78,059,731 S368R probably null Het
Egfr A G 11: 16,904,434 K869E probably damaging Het
Ehd1 G A 19: 6,297,694 M359I probably benign Het
F5 A T 1: 164,195,570 T1566S probably benign Het
Fam207a A G 10: 77,490,016 V154A probably benign Het
Flrt2 T C 12: 95,778,951 I21T probably benign Het
Galnt1 T A 18: 24,271,755 I383K probably benign Het
Ghdc G T 11: 100,766,834 A523D probably damaging Het
Gm24022 A G 12: 113,429,779 probably benign Het
Golga3 T C 5: 110,205,777 S934P probably damaging Het
Gpr135 T A 12: 72,070,508 T162S probably benign Het
Gucd1 G A 10: 75,517,202 probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ick T C 9: 78,131,519 S17P probably damaging Het
Igkv6-15 T C 6: 70,406,649 Y56C probably damaging Het
Il22ra1 A T 4: 135,733,104 Y57F probably damaging Het
Irak4 A G 15: 94,558,273 E247G possibly damaging Het
Kank3 T C 17: 33,821,772 V13A possibly damaging Het
Klhl1 A T 14: 96,136,610 S667T probably damaging Het
Klhl6 T G 16: 19,946,991 *620C probably null Het
Lct A G 1: 128,308,241 L343P probably damaging Het
Lgr6 G T 1: 134,990,632 P264T probably benign Het
Lilrb4a T A 10: 51,491,420 probably null Het
Lin7a G T 10: 107,382,669 G25* probably null Het
Lmnb2 G A 10: 80,918,112 T36M probably damaging Het
Manba T C 3: 135,567,630 F775S probably benign Het
March6 A G 15: 31,465,322 V812A probably damaging Het
Megf6 T A 4: 154,268,060 L1292H probably damaging Het
Myo18b T G 5: 112,761,340 Q1979P probably damaging Het
Myoz1 T C 14: 20,653,701 M59V probably damaging Het
Naa35 T C 13: 59,625,531 I100T possibly damaging Het
Nox4 A T 7: 87,360,803 Y404F probably damaging Het
Ntn1 T C 11: 68,260,532 Y441C probably damaging Het
Olfr1329 C A 4: 118,917,243 V75F probably damaging Het
Olfr351 T C 2: 36,860,070 T93A probably benign Het
Olfr984 G A 9: 40,101,227 H88Y probably benign Het
Onecut3 A G 10: 80,495,320 T105A unknown Het
Pabpc1l A G 2: 164,042,518 S392G probably benign Het
Pan3 T A 5: 147,526,682 probably null Het
Pcdha4 G A 18: 36,954,948 S728N probably benign Het
Pds5a T C 5: 65,696,785 D38G probably damaging Het
Pgm2l1 A G 7: 100,272,376 I605V probably benign Het
Phip T C 9: 82,896,019 probably null Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Ppp2r2a A T 14: 67,022,308 L313* probably null Het
Ppp4c A G 7: 126,787,537 F126S probably damaging Het
Ptger2 C A 14: 44,989,367 R135S probably damaging Het
Rab11fip5 T A 6: 85,347,806 E506D probably damaging Het
Rdh12 G A 12: 79,212,742 G133R probably damaging Het
Rims2 A T 15: 39,452,428 D610V probably benign Het
Saa1 T A 7: 46,740,708 Y122F probably damaging Het
Sept10 A T 10: 59,176,989 V269E probably damaging Het
Serpina3n T A 12: 104,408,739 D23E probably benign Het
Serpinb11 A G 1: 107,376,868 K188E possibly damaging Het
Slc18a3 C T 14: 32,463,779 V216M possibly damaging Het
Slc19a3 G T 1: 83,022,620 N225K probably benign Het
Slc4a1 T A 11: 102,351,503 I797F probably benign Het
Spic A G 10: 88,675,899 M165T possibly damaging Het
Timm44 A T 8: 4,275,886 M1K probably null Het
Tmc6 A G 11: 117,770,784 L572P probably benign Het
Tnc G A 4: 63,984,489 T1517I probably damaging Het
Tnc G A 4: 64,000,062 T1204M probably benign Het
Trip11 A T 12: 101,884,910 L680* probably null Het
Trps1 T A 15: 50,661,307 M887L possibly damaging Het
Tulp3 A C 6: 128,325,068 V330G probably damaging Het
Upf1 A G 8: 70,334,700 S835P probably damaging Het
Wdr64 A G 1: 175,792,959 probably null Het
Zbtb40 A G 4: 136,996,150 L643P probably damaging Het
Zc3h18 A T 8: 122,383,520 D36V probably damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGAGTCAGTGTCCCACAAAGTG -3'
(R):5'- ACAGATGACTCCAGCATCTTCC -3'

Sequencing Primer
(F):5'- GTGTCCCACAAAGTGTACAAGGTC -3'
(R):5'- TGTCCACAGTTATGAGAGAGCC -3'
Posted On2016-06-06