Incidental Mutation 'R0436:D430041D05Rik'
ID38992
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene NameRIKEN cDNA D430041D05 gene
SynonymsG2
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R0436 (G1)
Quality Score122
Status Validated
Chromosome2
Chromosomal Location104143073-104411013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 104167950 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 1836 (P1836R)
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
Predicted Effect probably damaging
Transcript: ENSMUST00000089726
AA Change: P1151R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: P1151R

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136156
AA Change: P1152R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000141159
AA Change: P1037R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: P1037R

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000230671
AA Change: P1836R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5321 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104201303 missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104258166 nonsense probably null
IGL01669:D430041D05Rik APN 2 104254961 missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104230404 missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104208214 splice site probably benign
IGL02268:D430041D05Rik APN 2 104241155 missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104255006 missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104249345 missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104230286 missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104248266 missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104230305 missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104214259 missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104241163 missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104221211 missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104248374 missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104255044 missense probably benign
R0064:D430041D05Rik UTSW 2 104249157 missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104255034 missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104205200 missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104201244 missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104255340 missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 104168164 missense probably damaging 0.99
R0441:D430041D05Rik UTSW 2 104167947 missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104230306 missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104230428 missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104249345 missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104258329 missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104201303 missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 104155018 missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104208083 missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104221208 small deletion probably benign
R1604:D430041D05Rik UTSW 2 104205142 missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104255570 missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 104152963 missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104221211 missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 104168101 missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104230455 missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 104148830 missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104255315 missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104255058 missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104257368 missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104256339 missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104192433 critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104233479 missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104258443 missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104214096 missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104201110 critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104255409 missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104255387 missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104258502 missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104256600 missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104255409 missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104248284 missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104248285 missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 104168067 missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104256292 missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 104168203 splice site probably null
R6804:D430041D05Rik UTSW 2 104149026 missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104201259 missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104241155 missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104192538 missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104258353 missense probably benign 0.06
R7250:D430041D05Rik UTSW 2 104256616 missense possibly damaging 0.92
R7251:D430041D05Rik UTSW 2 104221166 missense probably damaging 1.00
R7313:D430041D05Rik UTSW 2 104255565 missense probably benign
R7359:D430041D05Rik UTSW 2 104214137 missense probably damaging 1.00
R7361:D430041D05Rik UTSW 2 104255018 missense possibly damaging 0.46
R7436:D430041D05Rik UTSW 2 104257102 missense probably benign 0.02
R7472:D430041D05Rik UTSW 2 104410139 missense unknown
R7492:D430041D05Rik UTSW 2 104201305 missense probably damaging 1.00
R7631:D430041D05Rik UTSW 2 104149018 nonsense probably null
R7672:D430041D05Rik UTSW 2 104241236 missense probably benign 0.01
R7721:D430041D05Rik UTSW 2 104258529 missense probably benign 0.00
R7754:D430041D05Rik UTSW 2 104257159 missense probably benign 0.01
X0024:D430041D05Rik UTSW 2 104192566 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCACGGCTTGTCCCTAAATTC -3'
(R):5'- TGTTTGATCCCACAGACTGAGCCC -3'

Sequencing Primer
(F):5'- AATTCCAAAATTCTTGCTCTGGGTC -3'
(R):5'- CAGACTGAGCCCGAGATCATAG -3'
Posted On2013-05-23