Mutagenetix > Incidental Mutation

Incidental Mutation 'R5001:Cfap54'

389935

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

042595-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5001 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92964534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1604 (V1604A)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000168110
AA Change: V1604A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: V1604A

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212902
AA Change: V1604A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy3	G	A	12: 4,198,434	V499M	possibly damaging	Het
Aff4	T	C	11: 53,404,357	S795P	probably damaging	Het
Ank	G	A	15: 27,562,733	V176I	probably damaging	Het
Ankfn1	A	G	11: 89,441,442	I446T	possibly damaging	Het
Arhgap33	C	A	7: 30,533,016	S32I	possibly damaging	Het
Ascc3	T	A	10: 50,823,648	Y1856N	probably damaging	Het
Atf3	T	C	1: 191,177,275	T66A	probably benign	Het
Atf7ip	T	C	6: 136,561,388	C548R	probably damaging	Het
Bag6	A	G	17: 35,145,176	T841A	probably damaging	Het
Bbof1	A	T	12: 84,426,856	Q320L	possibly damaging	Het
Bmp2k	A	T	5: 97,053,142	Q307L	probably damaging	Het
Btaf1	T	A	19: 36,986,652	N874K	possibly damaging	Het
Calr4	G	A	4: 109,238,982		probably null	Het
Camk1d	T	C	2: 5,313,101	I248V	possibly damaging	Het
Ccdc130	G	A	8: 84,258,675	P322S	probably benign	Het
Ccdc177	G	A	12: 80,757,386	R705C	unknown	Het
Cdk18	C	T	1: 132,118,849		probably null	Het
Cers4	A	G	8: 4,515,565	S4G	probably benign	Het
Chd8	C	T	14: 52,203,915	G907S	probably benign	Het
Cnksr3	G	A	10: 7,126,746	Q149*	probably null	Het
Cntd1	T	C	11: 101,285,731	V218A	possibly damaging	Het
Cog7	A	T	7: 121,949,886	V384E	probably damaging	Het
Col5a2	A	G	1: 45,502,898	V6A	unknown	Het
Col7a1	T	C	9: 108,965,078		probably null	Het
Cpsf6	T	A	10: 117,367,961	I29L	possibly damaging	Het
Cyp3a13	T	C	5: 137,898,916	T379A	probably benign	Het
Ddx46	T	C	13: 55,652,919	S296P	probably damaging	Het
Dmbt1	A	G	7: 131,050,012	D328G	probably damaging	Het
Dnah8	T	G	17: 30,787,185	L3692W	probably damaging	Het
Dnmt3l	A	C	10: 78,059,731	S368R	probably null	Het
Egfr	A	G	11: 16,904,434	K869E	probably damaging	Het
Ehd1	G	A	19: 6,297,694	M359I	probably benign	Het
F5	A	T	1: 164,195,570	T1566S	probably benign	Het
Fam207a	A	G	10: 77,490,016	V154A	probably benign	Het
Flrt2	T	C	12: 95,778,951	I21T	probably benign	Het
Galnt1	T	A	18: 24,271,755	I383K	probably benign	Het
Ghdc	G	T	11: 100,766,834	A523D	probably damaging	Het
Gm24022	A	G	12: 113,429,779		probably benign	Het
Golga3	T	C	5: 110,205,777	S934P	probably damaging	Het
Gpr135	T	A	12: 72,070,508	T162S	probably benign	Het
Gucd1	G	A	10: 75,517,202		probably null	Het
Hcrtr2	T	A	9: 76,230,604	I410F	probably benign	Het
Ick	T	C	9: 78,131,519	S17P	probably damaging	Het
Igkv6-15	T	C	6: 70,406,649	Y56C	probably damaging	Het
Il22ra1	A	T	4: 135,733,104	Y57F	probably damaging	Het
Irak4	A	G	15: 94,558,273	E247G	possibly damaging	Het
Kank3	T	C	17: 33,821,772	V13A	possibly damaging	Het
Klhl1	A	T	14: 96,136,610	S667T	probably damaging	Het
Klhl6	T	G	16: 19,946,991	*620C	probably null	Het
Lct	A	G	1: 128,308,241	L343P	probably damaging	Het
Lgr6	G	T	1: 134,990,632	P264T	probably benign	Het
Lilrb4a	T	A	10: 51,491,420		probably null	Het
Lin7a	G	T	10: 107,382,669	G25*	probably null	Het
Lmnb2	G	A	10: 80,918,112	T36M	probably damaging	Het
Manba	T	C	3: 135,567,630	F775S	probably benign	Het
March6	A	G	15: 31,465,322	V812A	probably damaging	Het
Megf6	T	A	4: 154,268,060	L1292H	probably damaging	Het
Myo18b	T	G	5: 112,761,340	Q1979P	probably damaging	Het
Myoz1	T	C	14: 20,653,701	M59V	probably damaging	Het
Naa35	T	C	13: 59,625,531	I100T	possibly damaging	Het
Nox4	A	T	7: 87,360,803	Y404F	probably damaging	Het
Ntn1	T	C	11: 68,260,532	Y441C	probably damaging	Het
Olfr1329	C	A	4: 118,917,243	V75F	probably damaging	Het
Olfr351	T	C	2: 36,860,070	T93A	probably benign	Het
Olfr984	G	A	9: 40,101,227	H88Y	probably benign	Het
Onecut3	A	G	10: 80,495,320	T105A	unknown	Het
Pabpc1l	A	G	2: 164,042,518	S392G	probably benign	Het
Pan3	T	A	5: 147,526,682		probably null	Het
Pcdha4	G	A	18: 36,954,948	S728N	probably benign	Het
Pds5a	T	C	5: 65,696,785	D38G	probably damaging	Het
Pgm2l1	A	G	7: 100,272,376	I605V	probably benign	Het
Phip	T	C	9: 82,896,019		probably null	Het
Pilra	T	C	5: 137,835,515	I96M	probably damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Ppp2r2a	A	T	14: 67,022,308	L313*	probably null	Het
Ppp4c	A	G	7: 126,787,537	F126S	probably damaging	Het
Ptger2	C	A	14: 44,989,367	R135S	probably damaging	Het
Rab11fip5	T	A	6: 85,347,806	E506D	probably damaging	Het
Rdh12	G	A	12: 79,212,742	G133R	probably damaging	Het
Rims2	A	T	15: 39,452,428	D610V	probably benign	Het
Saa1	T	A	7: 46,740,708	Y122F	probably damaging	Het
Sept10	A	T	10: 59,176,989	V269E	probably damaging	Het
Serpina3n	T	A	12: 104,408,739	D23E	probably benign	Het
Serpinb11	A	G	1: 107,376,868	K188E	possibly damaging	Het
Slc18a3	C	T	14: 32,463,779	V216M	possibly damaging	Het
Slc19a3	G	T	1: 83,022,620	N225K	probably benign	Het
Slc4a1	T	A	11: 102,351,503	I797F	probably benign	Het
Spic	A	G	10: 88,675,899	M165T	possibly damaging	Het
Timm44	A	T	8: 4,275,886	M1K	probably null	Het
Tmc6	A	G	11: 117,770,784	L572P	probably benign	Het
Tnc	G	A	4: 64,000,062	T1204M	probably benign	Het
Tnc	G	A	4: 63,984,489	T1517I	probably damaging	Het
Trip11	A	T	12: 101,884,910	L680*	probably null	Het
Trps1	T	A	15: 50,661,307	M887L	possibly damaging	Het
Tulp3	A	C	6: 128,325,068	V330G	probably damaging	Het
Upf1	A	G	8: 70,334,700	S835P	probably damaging	Het
Wdr64	A	G	1: 175,792,959		probably null	Het
Zbtb40	A	G	4: 136,996,150	L643P	probably damaging	Het
Zc3h18	A	T	8: 122,383,520	D36V	probably damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAAGCCTAGCAAGAAATCTG -3'
(R):5'- GCGACATATGTCACCTTTATGG -3'

Sequencing Primer
(F):5'- GCCTAGCAAGAAATCTGTATGTAG -3'
(R):5'- CGACATATGTCACCTTTATGGGAATG -3'

Posted On

2016-06-06