Incidental Mutation 'R5001:Trip11'
ID389952
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission 042595-MU
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5001 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 101884910 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 680 (L680*)
Ref Sequence ENSEMBL: ENSMUSP00000134976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect probably null
Transcript: ENSMUST00000021605
AA Change: L965*
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: L965*

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177183
AA Change: L680*
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: L680*

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 G A 12: 4,198,434 V499M possibly damaging Het
Aff4 T C 11: 53,404,357 S795P probably damaging Het
Ank G A 15: 27,562,733 V176I probably damaging Het
Ankfn1 A G 11: 89,441,442 I446T possibly damaging Het
Arhgap33 C A 7: 30,533,016 S32I possibly damaging Het
Ascc3 T A 10: 50,823,648 Y1856N probably damaging Het
Atf3 T C 1: 191,177,275 T66A probably benign Het
Atf7ip T C 6: 136,561,388 C548R probably damaging Het
Bag6 A G 17: 35,145,176 T841A probably damaging Het
Bbof1 A T 12: 84,426,856 Q320L possibly damaging Het
Bmp2k A T 5: 97,053,142 Q307L probably damaging Het
Btaf1 T A 19: 36,986,652 N874K possibly damaging Het
Calr4 G A 4: 109,238,982 probably null Het
Camk1d T C 2: 5,313,101 I248V possibly damaging Het
Ccdc130 G A 8: 84,258,675 P322S probably benign Het
Ccdc177 G A 12: 80,757,386 R705C unknown Het
Cdk18 C T 1: 132,118,849 probably null Het
Cers4 A G 8: 4,515,565 S4G probably benign Het
Cfap54 A G 10: 92,964,534 V1604A probably benign Het
Chd8 C T 14: 52,203,915 G907S probably benign Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Cntd1 T C 11: 101,285,731 V218A possibly damaging Het
Cog7 A T 7: 121,949,886 V384E probably damaging Het
Col5a2 A G 1: 45,502,898 V6A unknown Het
Col7a1 T C 9: 108,965,078 probably null Het
Cpsf6 T A 10: 117,367,961 I29L possibly damaging Het
Cyp3a13 T C 5: 137,898,916 T379A probably benign Het
Ddx46 T C 13: 55,652,919 S296P probably damaging Het
Dmbt1 A G 7: 131,050,012 D328G probably damaging Het
Dnah8 T G 17: 30,787,185 L3692W probably damaging Het
Dnmt3l A C 10: 78,059,731 S368R probably null Het
Egfr A G 11: 16,904,434 K869E probably damaging Het
Ehd1 G A 19: 6,297,694 M359I probably benign Het
F5 A T 1: 164,195,570 T1566S probably benign Het
Fam207a A G 10: 77,490,016 V154A probably benign Het
Flrt2 T C 12: 95,778,951 I21T probably benign Het
Galnt1 T A 18: 24,271,755 I383K probably benign Het
Ghdc G T 11: 100,766,834 A523D probably damaging Het
Gm24022 A G 12: 113,429,779 probably benign Het
Golga3 T C 5: 110,205,777 S934P probably damaging Het
Gpr135 T A 12: 72,070,508 T162S probably benign Het
Gucd1 G A 10: 75,517,202 probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ick T C 9: 78,131,519 S17P probably damaging Het
Igkv6-15 T C 6: 70,406,649 Y56C probably damaging Het
Il22ra1 A T 4: 135,733,104 Y57F probably damaging Het
Irak4 A G 15: 94,558,273 E247G possibly damaging Het
Kank3 T C 17: 33,821,772 V13A possibly damaging Het
Klhl1 A T 14: 96,136,610 S667T probably damaging Het
Klhl6 T G 16: 19,946,991 *620C probably null Het
Lct A G 1: 128,308,241 L343P probably damaging Het
Lgr6 G T 1: 134,990,632 P264T probably benign Het
Lilrb4a T A 10: 51,491,420 probably null Het
Lin7a G T 10: 107,382,669 G25* probably null Het
Lmnb2 G A 10: 80,918,112 T36M probably damaging Het
Manba T C 3: 135,567,630 F775S probably benign Het
March6 A G 15: 31,465,322 V812A probably damaging Het
Megf6 T A 4: 154,268,060 L1292H probably damaging Het
Myo18b T G 5: 112,761,340 Q1979P probably damaging Het
Myoz1 T C 14: 20,653,701 M59V probably damaging Het
Naa35 T C 13: 59,625,531 I100T possibly damaging Het
Nox4 A T 7: 87,360,803 Y404F probably damaging Het
Ntn1 T C 11: 68,260,532 Y441C probably damaging Het
Olfr1329 C A 4: 118,917,243 V75F probably damaging Het
Olfr351 T C 2: 36,860,070 T93A probably benign Het
Olfr984 G A 9: 40,101,227 H88Y probably benign Het
Onecut3 A G 10: 80,495,320 T105A unknown Het
Pabpc1l A G 2: 164,042,518 S392G probably benign Het
Pan3 T A 5: 147,526,682 probably null Het
Pcdha4 G A 18: 36,954,948 S728N probably benign Het
Pds5a T C 5: 65,696,785 D38G probably damaging Het
Pgm2l1 A G 7: 100,272,376 I605V probably benign Het
Phip T C 9: 82,896,019 probably null Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Ppp2r2a A T 14: 67,022,308 L313* probably null Het
Ppp4c A G 7: 126,787,537 F126S probably damaging Het
Ptger2 C A 14: 44,989,367 R135S probably damaging Het
Rab11fip5 T A 6: 85,347,806 E506D probably damaging Het
Rdh12 G A 12: 79,212,742 G133R probably damaging Het
Rims2 A T 15: 39,452,428 D610V probably benign Het
Saa1 T A 7: 46,740,708 Y122F probably damaging Het
Sept10 A T 10: 59,176,989 V269E probably damaging Het
Serpina3n T A 12: 104,408,739 D23E probably benign Het
Serpinb11 A G 1: 107,376,868 K188E possibly damaging Het
Slc18a3 C T 14: 32,463,779 V216M possibly damaging Het
Slc19a3 G T 1: 83,022,620 N225K probably benign Het
Slc4a1 T A 11: 102,351,503 I797F probably benign Het
Spic A G 10: 88,675,899 M165T possibly damaging Het
Timm44 A T 8: 4,275,886 M1K probably null Het
Tmc6 A G 11: 117,770,784 L572P probably benign Het
Tnc G A 4: 63,984,489 T1517I probably damaging Het
Tnc G A 4: 64,000,062 T1204M probably benign Het
Trps1 T A 15: 50,661,307 M887L possibly damaging Het
Tulp3 A C 6: 128,325,068 V330G probably damaging Het
Upf1 A G 8: 70,334,700 S835P probably damaging Het
Wdr64 A G 1: 175,792,959 probably null Het
Zbtb40 A G 4: 136,996,150 L643P probably damaging Het
Zc3h18 A T 8: 122,383,520 D36V probably damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 splice site probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
R7752:Trip11 UTSW 12 101886974 missense probably benign 0.01
R7763:Trip11 UTSW 12 101844855 missense probably benign 0.03
R7779:Trip11 UTSW 12 101883537 missense probably damaging 0.97
R7844:Trip11 UTSW 12 101878144 missense probably damaging 1.00
R8055:Trip11 UTSW 12 101837665 missense probably damaging 1.00
R8076:Trip11 UTSW 12 101883482 missense probably damaging 1.00
R8288:Trip11 UTSW 12 101894384 missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101844901 missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101912804 missense unknown
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTGATCTCCAGCTCCC -3'
(R):5'- TGCACAGAATCAAGGGTCATC -3'

Sequencing Primer
(F):5'- GATCTCCAGCTCCCTCTCC -3'
(R):5'- TCTGGAAGAAGAGATTAAACATCACC -3'
Posted On2016-06-06