Incidental Mutation 'R5001:Dnah8'
ID 389970
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms P1-Loop, Dnahc8, Hst6.7b
MMRRC Submission 042595-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R5001 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30845909-31094736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31006159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 3692 (L3692W)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000170651
AA Change: L3692W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: L3692W

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 G A 12: 4,248,434 (GRCm39) V499M possibly damaging Het
Aff4 T C 11: 53,295,184 (GRCm39) S795P probably damaging Het
Ank G A 15: 27,562,819 (GRCm39) V176I probably damaging Het
Ankfn1 A G 11: 89,332,268 (GRCm39) I446T possibly damaging Het
Arhgap33 C A 7: 30,232,441 (GRCm39) S32I possibly damaging Het
Ascc3 T A 10: 50,699,744 (GRCm39) Y1856N probably damaging Het
Atf3 T C 1: 190,909,472 (GRCm39) T66A probably benign Het
Atf7ip T C 6: 136,538,386 (GRCm39) C548R probably damaging Het
Bag6 A G 17: 35,364,152 (GRCm39) T841A probably damaging Het
Bbof1 A T 12: 84,473,630 (GRCm39) Q320L possibly damaging Het
Bmp2k A T 5: 97,201,001 (GRCm39) Q307L probably damaging Het
Btaf1 T A 19: 36,964,052 (GRCm39) N874K possibly damaging Het
Calr4 G A 4: 109,096,179 (GRCm39) probably null Het
Camk1d T C 2: 5,317,912 (GRCm39) I248V possibly damaging Het
Ccdc177 G A 12: 80,804,160 (GRCm39) R705C unknown Het
Cdk18 C T 1: 132,046,587 (GRCm39) probably null Het
Cers4 A G 8: 4,565,565 (GRCm39) S4G probably benign Het
Cfap54 A G 10: 92,800,396 (GRCm39) V1604A probably benign Het
Chd8 C T 14: 52,441,372 (GRCm39) G907S probably benign Het
Cilk1 T C 9: 78,038,801 (GRCm39) S17P probably damaging Het
Cnksr3 G A 10: 7,076,746 (GRCm39) Q149* probably null Het
Cntd1 T C 11: 101,176,557 (GRCm39) V218A possibly damaging Het
Cog7 A T 7: 121,549,109 (GRCm39) V384E probably damaging Het
Col5a2 A G 1: 45,542,058 (GRCm39) V6A unknown Het
Col7a1 T C 9: 108,794,146 (GRCm39) probably null Het
Cpsf6 T A 10: 117,203,866 (GRCm39) I29L possibly damaging Het
Cyp3a13 T C 5: 137,897,178 (GRCm39) T379A probably benign Het
Ddx46 T C 13: 55,800,732 (GRCm39) S296P probably damaging Het
Dmbt1 A G 7: 130,651,742 (GRCm39) D328G probably damaging Het
Dnmt3l A C 10: 77,895,565 (GRCm39) S368R probably null Het
Egfr A G 11: 16,854,434 (GRCm39) K869E probably damaging Het
Ehd1 G A 19: 6,347,724 (GRCm39) M359I probably benign Het
F5 A T 1: 164,023,139 (GRCm39) T1566S probably benign Het
Flrt2 T C 12: 95,745,725 (GRCm39) I21T probably benign Het
Galnt1 T A 18: 24,404,812 (GRCm39) I383K probably benign Het
Ghdc G T 11: 100,657,660 (GRCm39) A523D probably damaging Het
Gm24022 A G 12: 113,393,399 (GRCm39) probably benign Het
Golga3 T C 5: 110,353,643 (GRCm39) S934P probably damaging Het
Gpr135 T A 12: 72,117,282 (GRCm39) T162S probably benign Het
Gucd1 G A 10: 75,353,036 (GRCm39) probably null Het
Hcrtr2 T A 9: 76,137,886 (GRCm39) I410F probably benign Het
Igkv6-15 T C 6: 70,383,633 (GRCm39) Y56C probably damaging Het
Il22ra1 A T 4: 135,460,415 (GRCm39) Y57F probably damaging Het
Irak4 A G 15: 94,456,154 (GRCm39) E247G possibly damaging Het
Kank3 T C 17: 34,040,746 (GRCm39) V13A possibly damaging Het
Klhl1 A T 14: 96,374,046 (GRCm39) S667T probably damaging Het
Klhl6 T G 16: 19,765,741 (GRCm39) *620C probably null Het
Lct A G 1: 128,235,978 (GRCm39) L343P probably damaging Het
Lgr6 G T 1: 134,918,370 (GRCm39) P264T probably benign Het
Lilrb4a T A 10: 51,367,516 (GRCm39) probably null Het
Lin7a G T 10: 107,218,530 (GRCm39) G25* probably null Het
Lmnb2 G A 10: 80,753,946 (GRCm39) T36M probably damaging Het
Manba T C 3: 135,273,391 (GRCm39) F775S probably benign Het
Marchf6 A G 15: 31,465,468 (GRCm39) V812A probably damaging Het
Megf6 T A 4: 154,352,517 (GRCm39) L1292H probably damaging Het
Myo18b T G 5: 112,909,206 (GRCm39) Q1979P probably damaging Het
Myoz1 T C 14: 20,703,769 (GRCm39) M59V probably damaging Het
Naa35 T C 13: 59,773,345 (GRCm39) I100T possibly damaging Het
Nox4 A T 7: 87,010,011 (GRCm39) Y404F probably damaging Het
Ntn1 T C 11: 68,151,358 (GRCm39) Y441C probably damaging Het
Onecut3 A G 10: 80,331,154 (GRCm39) T105A unknown Het
Or10ak8 C A 4: 118,774,440 (GRCm39) V75F probably damaging Het
Or1n1 T C 2: 36,750,082 (GRCm39) T93A probably benign Het
Or4d5 G A 9: 40,012,523 (GRCm39) H88Y probably benign Het
Pabpc1l A G 2: 163,884,438 (GRCm39) S392G probably benign Het
Pan3 T A 5: 147,463,492 (GRCm39) probably null Het
Pcdha4 G A 18: 37,088,001 (GRCm39) S728N probably benign Het
Pds5a T C 5: 65,854,128 (GRCm39) D38G probably damaging Het
Pgm2l1 A G 7: 99,921,583 (GRCm39) I605V probably benign Het
Phip T C 9: 82,778,072 (GRCm39) probably null Het
Pilra T C 5: 137,833,777 (GRCm39) I96M probably damaging Het
Ppig T A 2: 69,571,830 (GRCm39) V183D unknown Het
Ppp2r2a A T 14: 67,259,757 (GRCm39) L313* probably null Het
Ppp4c A G 7: 126,386,709 (GRCm39) F126S probably damaging Het
Ptger2 C A 14: 45,226,824 (GRCm39) R135S probably damaging Het
Rab11fip5 T A 6: 85,324,788 (GRCm39) E506D probably damaging Het
Rdh12 G A 12: 79,259,516 (GRCm39) G133R probably damaging Het
Rims2 A T 15: 39,315,824 (GRCm39) D610V probably benign Het
Saa1 T A 7: 46,390,132 (GRCm39) Y122F probably damaging Het
Septin10 A T 10: 59,012,811 (GRCm39) V269E probably damaging Het
Serpina3n T A 12: 104,374,998 (GRCm39) D23E probably benign Het
Serpinb11 A G 1: 107,304,598 (GRCm39) K188E possibly damaging Het
Slc18a3 C T 14: 32,185,736 (GRCm39) V216M possibly damaging Het
Slc19a3 G T 1: 83,000,341 (GRCm39) N225K probably benign Het
Slc4a1 T A 11: 102,242,329 (GRCm39) I797F probably benign Het
Slx9 A G 10: 77,325,850 (GRCm39) V154A probably benign Het
Spic A G 10: 88,511,761 (GRCm39) M165T possibly damaging Het
Timm44 A T 8: 4,325,886 (GRCm39) M1K probably null Het
Tmc6 A G 11: 117,661,610 (GRCm39) L572P probably benign Het
Tnc G A 4: 63,918,299 (GRCm39) T1204M probably benign Het
Tnc G A 4: 63,902,726 (GRCm39) T1517I probably damaging Het
Trip11 A T 12: 101,851,169 (GRCm39) L680* probably null Het
Trps1 T A 15: 50,524,703 (GRCm39) M887L possibly damaging Het
Tulp3 A C 6: 128,302,031 (GRCm39) V330G probably damaging Het
Upf1 A G 8: 70,787,350 (GRCm39) S835P probably damaging Het
Wdr64 A G 1: 175,620,525 (GRCm39) probably null Het
Yju2b G A 8: 84,985,304 (GRCm39) P322S probably benign Het
Zbtb40 A G 4: 136,723,461 (GRCm39) L643P probably damaging Het
Zc3h18 A T 8: 123,110,259 (GRCm39) D36V probably damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,896,150 (GRCm39) missense probably benign 0.06
IGL00508:Dnah8 APN 17 31,074,904 (GRCm39) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 31,034,677 (GRCm39) nonsense probably null
IGL00551:Dnah8 APN 17 30,882,452 (GRCm39) nonsense probably null
IGL00732:Dnah8 APN 17 30,875,615 (GRCm39) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,986,880 (GRCm39) nonsense probably null
IGL00840:Dnah8 APN 17 31,009,915 (GRCm39) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 31,038,250 (GRCm39) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,925,431 (GRCm39) nonsense probably null
IGL00976:Dnah8 APN 17 31,070,684 (GRCm39) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,854,979 (GRCm39) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,998,890 (GRCm39) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,902,688 (GRCm39) splice site probably benign
IGL01515:Dnah8 APN 17 30,867,459 (GRCm39) missense probably benign
IGL01723:Dnah8 APN 17 30,927,445 (GRCm39) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,970,565 (GRCm39) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,955,115 (GRCm39) missense probably benign
IGL01958:Dnah8 APN 17 31,074,869 (GRCm39) splice site probably benign
IGL01968:Dnah8 APN 17 30,875,572 (GRCm39) nonsense probably null
IGL02093:Dnah8 APN 17 30,936,854 (GRCm39) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,867,391 (GRCm39) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 31,013,737 (GRCm39) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,925,487 (GRCm39) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,868,747 (GRCm39) nonsense probably null
IGL02259:Dnah8 APN 17 30,978,588 (GRCm39) missense probably benign
IGL02263:Dnah8 APN 17 30,948,139 (GRCm39) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,932,021 (GRCm39) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,966,231 (GRCm39) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 31,013,770 (GRCm39) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 31,049,819 (GRCm39) missense probably benign 0.01
IGL02392:Dnah8 APN 17 31,037,025 (GRCm39) splice site probably benign
IGL02414:Dnah8 APN 17 30,919,387 (GRCm39) missense probably benign
IGL02455:Dnah8 APN 17 30,891,308 (GRCm39) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,887,269 (GRCm39) missense probably benign
IGL02831:Dnah8 APN 17 30,931,250 (GRCm39) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,988,671 (GRCm39) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,940,084 (GRCm39) nonsense probably null
IGL02954:Dnah8 APN 17 30,923,809 (GRCm39) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,965,735 (GRCm39) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,937,980 (GRCm39) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,905,347 (GRCm39) splice site probably benign
IGL03086:Dnah8 APN 17 30,961,754 (GRCm39) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 31,003,118 (GRCm39) missense probably benign
IGL03176:Dnah8 APN 17 30,913,011 (GRCm39) missense probably benign
IGL03191:Dnah8 APN 17 30,945,804 (GRCm39) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 31,034,639 (GRCm39) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,892,894 (GRCm39) splice site probably null
IGL03255:Dnah8 APN 17 30,960,355 (GRCm39) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,891,323 (GRCm39) missense probably benign
IGL03348:Dnah8 APN 17 30,965,960 (GRCm39) missense probably damaging 0.99
Alternator UTSW 17 30,984,609 (GRCm39) missense probably benign
armature UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
Brush UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
Dynos UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
joule UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
solenoid UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,854,437 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,451 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,439 (GRCm39) small deletion probably benign
I2288:Dnah8 UTSW 17 30,882,428 (GRCm39) missense probably benign
P0029:Dnah8 UTSW 17 30,984,694 (GRCm39) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,927,419 (GRCm39) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,882,290 (GRCm39) missense probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,974,093 (GRCm39) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 31,003,064 (GRCm39) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0184:Dnah8 UTSW 17 30,902,657 (GRCm39) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,909,245 (GRCm39) missense probably benign
R0268:Dnah8 UTSW 17 30,988,681 (GRCm39) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,955,130 (GRCm39) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 31,090,325 (GRCm39) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,920,955 (GRCm39) missense probably benign
R0470:Dnah8 UTSW 17 30,927,514 (GRCm39) splice site probably benign
R0477:Dnah8 UTSW 17 30,974,054 (GRCm39) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R0499:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,937,935 (GRCm39) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,927,332 (GRCm39) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,903,147 (GRCm39) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,955,129 (GRCm39) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,923,636 (GRCm39) missense probably benign
R0843:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 31,022,217 (GRCm39) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,892,894 (GRCm39) splice site probably null
R1102:Dnah8 UTSW 17 31,073,738 (GRCm39) splice site probably null
R1137:Dnah8 UTSW 17 31,074,910 (GRCm39) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,939,974 (GRCm39) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,956,269 (GRCm39) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 31,059,596 (GRCm39) nonsense probably null
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1497:Dnah8 UTSW 17 30,971,049 (GRCm39) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,892,862 (GRCm39) missense probably benign
R1541:Dnah8 UTSW 17 30,966,221 (GRCm39) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,854,638 (GRCm39) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,944,098 (GRCm39) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 31,073,914 (GRCm39) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,988,625 (GRCm39) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,998,890 (GRCm39) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,941,911 (GRCm39) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,927,381 (GRCm39) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,903,160 (GRCm39) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,950,154 (GRCm39) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,854,479 (GRCm39) missense unknown
R1935:Dnah8 UTSW 17 30,945,870 (GRCm39) splice site probably benign
R1940:Dnah8 UTSW 17 30,950,181 (GRCm39) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,931,359 (GRCm39) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,950,133 (GRCm39) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,977,255 (GRCm39) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,854,632 (GRCm39) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,956,232 (GRCm39) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,872,367 (GRCm39) missense probably benign
R2180:Dnah8 UTSW 17 31,059,621 (GRCm39) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 31,013,718 (GRCm39) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,990,846 (GRCm39) missense probably benign
R2357:Dnah8 UTSW 17 31,093,909 (GRCm39) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,896,178 (GRCm39) missense probably benign 0.22
R2496:Dnah8 UTSW 17 31,070,705 (GRCm39) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,960,339 (GRCm39) nonsense probably null
R2509:Dnah8 UTSW 17 30,994,019 (GRCm39) missense probably benign 0.02
R3114:Dnah8 UTSW 17 31,052,542 (GRCm39) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,958,631 (GRCm39) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,958,622 (GRCm39) nonsense probably null
R3747:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3748:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3749:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3787:Dnah8 UTSW 17 30,974,015 (GRCm39) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,889,621 (GRCm39) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,882,396 (GRCm39) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 31,073,911 (GRCm39) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,913,039 (GRCm39) splice site probably benign
R4091:Dnah8 UTSW 17 30,988,813 (GRCm39) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,967,533 (GRCm39) missense probably benign
R4326:Dnah8 UTSW 17 30,971,066 (GRCm39) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,944,072 (GRCm39) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,971,120 (GRCm39) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 31,032,125 (GRCm39) missense probably benign
R4475:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,919,380 (GRCm39) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,881,026 (GRCm39) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,970,541 (GRCm39) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,903,211 (GRCm39) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,902,608 (GRCm39) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,944,140 (GRCm39) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 31,070,721 (GRCm39) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,986,898 (GRCm39) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,965,949 (GRCm39) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 31,059,688 (GRCm39) critical splice donor site probably null
R4913:Dnah8 UTSW 17 31,038,113 (GRCm39) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,948,116 (GRCm39) missense probably benign
R4969:Dnah8 UTSW 17 30,941,988 (GRCm39) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,882,275 (GRCm39) missense probably benign 0.00
R5011:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,955,070 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5075:Dnah8 UTSW 17 31,019,505 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,958,731 (GRCm39) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,950,012 (GRCm39) missense probably benign 0.02
R5121:Dnah8 UTSW 17 31,029,327 (GRCm39) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,984,571 (GRCm39) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,931,269 (GRCm39) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,965,739 (GRCm39) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 31,009,891 (GRCm39) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R5358:Dnah8 UTSW 17 30,965,928 (GRCm39) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5482:Dnah8 UTSW 17 31,019,521 (GRCm39) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 31,009,930 (GRCm39) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,971,890 (GRCm39) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,925,360 (GRCm39) missense probably benign 0.00
R5640:Dnah8 UTSW 17 31,022,082 (GRCm39) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 31,019,561 (GRCm39) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,956,307 (GRCm39) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 31,022,235 (GRCm39) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5699:Dnah8 UTSW 17 31,029,298 (GRCm39) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,937,981 (GRCm39) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,909,235 (GRCm39) missense probably benign 0.01
R5790:Dnah8 UTSW 17 31,093,978 (GRCm39) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,947,165 (GRCm39) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 31,013,737 (GRCm39) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,875,659 (GRCm39) missense probably benign 0.32
R5979:Dnah8 UTSW 17 31,034,638 (GRCm39) nonsense probably null
R5986:Dnah8 UTSW 17 31,070,604 (GRCm39) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,882,279 (GRCm39) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,966,239 (GRCm39) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,966,828 (GRCm39) nonsense probably null
R6239:Dnah8 UTSW 17 31,029,333 (GRCm39) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,984,609 (GRCm39) missense probably benign
R6443:Dnah8 UTSW 17 30,990,859 (GRCm39) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,882,266 (GRCm39) splice site probably null
R6765:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,854,640 (GRCm39) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,984,698 (GRCm39) frame shift probably null
R6788:Dnah8 UTSW 17 30,867,439 (GRCm39) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,960,147 (GRCm39) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,929,525 (GRCm39) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,965,933 (GRCm39) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 31,013,633 (GRCm39) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,986,899 (GRCm39) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,958,712 (GRCm39) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,881,065 (GRCm39) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,862,249 (GRCm39) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,923,698 (GRCm39) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 31,090,366 (GRCm39) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,988,618 (GRCm39) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,863,591 (GRCm39) missense probably benign 0.01
R7309:Dnah8 UTSW 17 31,093,988 (GRCm39) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 31,003,099 (GRCm39) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,986,939 (GRCm39) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,923,743 (GRCm39) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,925,363 (GRCm39) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 31,006,165 (GRCm39) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,994,077 (GRCm39) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 31,004,081 (GRCm39) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,868,651 (GRCm39) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,876,947 (GRCm39) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 31,074,918 (GRCm39) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R7866:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,882,348 (GRCm39) missense probably benign
R7891:Dnah8 UTSW 17 30,931,263 (GRCm39) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,960,311 (GRCm39) nonsense probably null
R8076:Dnah8 UTSW 17 31,003,127 (GRCm39) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,892,797 (GRCm39) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 31,090,393 (GRCm39) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8270:Dnah8 UTSW 17 31,059,687 (GRCm39) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,984,701 (GRCm39) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,988,805 (GRCm39) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8348:Dnah8 UTSW 17 30,955,121 (GRCm39) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,862,234 (GRCm39) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,914,152 (GRCm39) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8448:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8459:Dnah8 UTSW 17 30,944,221 (GRCm39) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,875,603 (GRCm39) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,940,108 (GRCm39) missense probably benign
R8524:Dnah8 UTSW 17 30,934,472 (GRCm39) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,940,084 (GRCm39) nonsense probably null
R8698:Dnah8 UTSW 17 31,094,009 (GRCm39) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,960,289 (GRCm39) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8781:Dnah8 UTSW 17 30,944,078 (GRCm39) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 31,013,712 (GRCm39) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,981,616 (GRCm39) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,927,286 (GRCm39) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 31,070,628 (GRCm39) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 31,009,807 (GRCm39) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,956,401 (GRCm39) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,975,729 (GRCm39) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,854,647 (GRCm39) missense probably benign 0.01
R9280:Dnah8 UTSW 17 31,004,071 (GRCm39) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,944,099 (GRCm39) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,990,857 (GRCm39) missense probably benign
R9347:Dnah8 UTSW 17 30,927,333 (GRCm39) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,872,361 (GRCm39) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 31,029,297 (GRCm39) missense probably benign 0.02
R9458:Dnah8 UTSW 17 31,049,777 (GRCm39) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9518:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9524:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9564:Dnah8 UTSW 17 30,932,021 (GRCm39) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9599:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9641:Dnah8 UTSW 17 30,932,029 (GRCm39) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,998,112 (GRCm39) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 31,037,115 (GRCm39) missense probably benign
R9789:Dnah8 UTSW 17 30,980,104 (GRCm39) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,854,450 (GRCm39) frame shift probably null
X0001:Dnah8 UTSW 17 30,967,654 (GRCm39) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 31,038,160 (GRCm39) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,867,514 (GRCm39) missense probably benign
Z1177:Dnah8 UTSW 17 30,932,069 (GRCm39) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,913,007 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGGCTCGTATTTGCAGG -3'
(R):5'- ACTCTGAGAGCACATTCTGAC -3'

Sequencing Primer
(F):5'- GGTTTGGTTCTTTTTCCCCACTAG -3'
(R):5'- TCTGAGAGCACATTCTGACTTACAC -3'
Posted On 2016-06-06