Incidental Mutation 'R5002:Casq1'
ID389980
Institutional Source Beutler Lab
Gene Symbol Casq1
Ensembl Gene ENSMUSG00000007122
Gene Namecalsequestrin 1
SynonymsCSQ-1, CSQ1, CSQ, sCSQ
MMRRC Submission 042596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5002 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172209894-172219868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172213378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 281 (D281V)
Ref Sequence ENSEMBL: ENSMUSP00000003554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000170700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003554
AA Change: D281V

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: D281V

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 402 5.3e-238 PFAM
Pfam:Thioredoxin_6 186 379 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170638
Predicted Effect probably benign
Transcript: ENSMUST00000170700
SMART Domains Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 94 9.7e-38 PFAM
Pfam:Calsequestrin 89 156 6.9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171429
Meta Mutation Damage Score 0.4825 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G C 10: 22,067,817 P88R probably damaging Het
Abca8b G A 11: 109,961,797 P736S probably damaging Het
Apbb2 A G 5: 66,313,325 I523T possibly damaging Het
Catsperb T C 12: 101,520,554 F447L probably benign Het
Cenpe A T 3: 135,247,081 M1511L probably benign Het
Cep128 T C 12: 91,255,723 probably null Het
Col6a6 T C 9: 105,786,093 T82A probably benign Het
Dna2 A G 10: 62,950,842 D123G probably damaging Het
Ergic2 A G 6: 148,184,158 I281T probably benign Het
Fcgbp T A 7: 28,086,103 probably null Het
Filip1l T C 16: 57,571,103 Y447H probably benign Het
Flnb T A 14: 7,945,882 M2429K probably damaging Het
Fn1 T A 1: 71,629,728 Q686L possibly damaging Het
Gm10644 T C 8: 83,933,587 D43G possibly damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm7534 T A 4: 134,196,920 N438I probably benign Het
Gpx6 A G 13: 21,313,688 Y43C probably damaging Het
Hhat A T 1: 192,543,190 F494I probably benign Het
Itga9 C A 9: 118,663,898 S287* probably null Het
Lrrk1 C A 7: 66,332,363 G177W probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Ms4a14 T C 19: 11,304,289 I302V probably benign Het
Nepn A C 10: 52,391,754 M39L probably benign Het
Nfil3 C A 13: 52,968,676 R64L probably damaging Het
Ociad1 T C 5: 73,310,316 V199A possibly damaging Het
Olfr1087 C A 2: 86,690,085 V297L possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Polk A G 13: 96,489,244 Y431H probably damaging Het
Prss33 C T 17: 23,835,358 probably benign Het
Slc12a7 A G 13: 73,763,777 N4S possibly damaging Het
Slc29a4 A T 5: 142,718,746 I348F probably damaging Het
Smarce1 T C 11: 99,225,063 N44S probably damaging Het
Spast C T 17: 74,369,226 Q344* probably null Het
Stk11ip C A 1: 75,532,543 probably benign Het
Tas2r131 T C 6: 132,957,151 I232V probably benign Het
Tesk1 T C 4: 43,444,573 Y126H probably damaging Het
Tmpo A G 10: 91,164,114 V164A possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vwc2l T G 1: 70,729,046 C43G probably damaging Het
Wnk1 G A 6: 119,937,963 T1626I probably benign Het
Other mutations in Casq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Casq1 APN 1 172213381 missense probably damaging 0.96
IGL02699:Casq1 APN 1 172219696 start gained probably benign
IGL02756:Casq1 APN 1 172215105 missense probably damaging 1.00
PIT4377001:Casq1 UTSW 1 172212001 missense probably benign 0.15
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0124:Casq1 UTSW 1 172210425 missense probably damaging 1.00
R0485:Casq1 UTSW 1 172210390 unclassified probably benign
R1982:Casq1 UTSW 1 172215530 missense probably damaging 1.00
R2095:Casq1 UTSW 1 172215962 missense probably benign 0.26
R2097:Casq1 UTSW 1 172210421 missense probably damaging 1.00
R3940:Casq1 UTSW 1 172219536 missense possibly damaging 0.91
R4654:Casq1 UTSW 1 172210398 unclassified probably benign
R4790:Casq1 UTSW 1 172216837 missense probably damaging 1.00
R5187:Casq1 UTSW 1 172213074 missense possibly damaging 0.54
R5307:Casq1 UTSW 1 172219416 missense probably damaging 1.00
R5973:Casq1 UTSW 1 172219501 missense probably damaging 1.00
R6251:Casq1 UTSW 1 172216840 missense probably benign 0.17
R6768:Casq1 UTSW 1 172219678 missense probably benign 0.04
R7380:Casq1 UTSW 1 172216849 missense probably benign 0.07
Z1176:Casq1 UTSW 1 172215914 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGCCATCTTGGAGGGAGC -3'
(R):5'- CCTAGAGCAGAAAGGATGCC -3'

Sequencing Primer
(F):5'- GGAAATGAGTCCAGACCTATTTCC -3'
(R):5'- GGATGCCATTAGAAAAGTCACC -3'
Posted On2016-06-06