Mutagenetix > Incidental Mutations

Incidental Mutation 'R5002:Casq1'

389980

Institutional Source

Beutler Lab

Gene Symbol

Casq1

Ensembl Gene

ENSMUSG00000007122

Gene Name

calsequestrin 1

Synonyms

CSQ-1, CSQ1, CSQ, sCSQ

MMRRC Submission

042596-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172209894-172219868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172213378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 281 (D281V)

Ref Sequence

ENSEMBL: ENSMUSP00000003554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000170700]

AlphaFold

O09165

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003554
AA Change: D281V

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: D281V

Domain	Start	End	E-Value	Type
Pfam:Calsequestrin	11	402	5.3e-238	PFAM
Pfam:Thioredoxin_6	186	379	2e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170638

Predicted Effect

probably benign
Transcript: ENSMUST00000170700

SMART Domains

Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122

Domain	Start	End	E-Value	Type
Pfam:Calsequestrin	11	94	9.7e-38	PFAM
Pfam:Calsequestrin	89	156	6.9e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171429

Meta Mutation Damage Score

0.4825

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	C	10: 22,067,817	P88R	probably damaging	Het
Abca8b	G	A	11: 109,961,797	P736S	probably damaging	Het
Apbb2	A	G	5: 66,313,325	I523T	possibly damaging	Het
Catsperb	T	C	12: 101,520,554	F447L	probably benign	Het
Cenpe	A	T	3: 135,247,081	M1511L	probably benign	Het
Cep128	T	C	12: 91,255,723		probably null	Het
Col6a6	T	C	9: 105,786,093	T82A	probably benign	Het
Dna2	A	G	10: 62,950,842	D123G	probably damaging	Het
Ergic2	A	G	6: 148,184,158	I281T	probably benign	Het
Fcgbp	T	A	7: 28,086,103		probably null	Het
Filip1l	T	C	16: 57,571,103	Y447H	probably benign	Het
Flnb	T	A	14: 7,945,882	M2429K	probably damaging	Het
Fn1	T	A	1: 71,629,728	Q686L	possibly damaging	Het
Gm10644	T	C	8: 83,933,587	D43G	possibly damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gm7534	T	A	4: 134,196,920	N438I	probably benign	Het
Gpx6	A	G	13: 21,313,688	Y43C	probably damaging	Het
Hhat	A	T	1: 192,543,190	F494I	probably benign	Het
Itga9	C	A	9: 118,663,898	S287*	probably null	Het
Lrrk1	C	A	7: 66,332,363	G177W	probably damaging	Het
Ltbp4	GT	G	7: 27,327,685		probably null	Het
Ms4a14	T	C	19: 11,304,289	I302V	probably benign	Het
Nepn	A	C	10: 52,391,754	M39L	probably benign	Het
Nfil3	C	A	13: 52,968,676	R64L	probably damaging	Het
Ociad1	T	C	5: 73,310,316	V199A	possibly damaging	Het
Olfr1087	C	A	2: 86,690,085	V297L	possibly damaging	Het
Olfr457	C	A	6: 42,471,972	V69L	probably benign	Het
Polk	A	G	13: 96,489,244	Y431H	probably damaging	Het
Prss33	C	T	17: 23,835,358		probably benign	Het
Slc12a7	A	G	13: 73,763,777	N4S	possibly damaging	Het
Slc29a4	A	T	5: 142,718,746	I348F	probably damaging	Het
Smarce1	T	C	11: 99,225,063	N44S	probably damaging	Het
Spast	C	T	17: 74,369,226	Q344*	probably null	Het
Stk11ip	C	A	1: 75,532,543		probably benign	Het
Tas2r131	T	C	6: 132,957,151	I232V	probably benign	Het
Tesk1	T	C	4: 43,444,573	Y126H	probably damaging	Het
Tmpo	A	G	10: 91,164,114	V164A	possibly damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vwc2l	T	G	1: 70,729,046	C43G	probably damaging	Het
Wnk1	G	A	6: 119,937,963	T1626I	probably benign	Het

Other mutations in Casq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02165:Casq1	APN	1	172213381	missense	probably damaging	0.96
IGL02699:Casq1	APN	1	172219696	start gained	probably benign
IGL02756:Casq1	APN	1	172215105	missense	probably damaging	1.00
PIT4377001:Casq1	UTSW	1	172212001	missense	probably benign	0.15
R0026:Casq1	UTSW	1	172219400	splice site	probably benign
R0026:Casq1	UTSW	1	172219400	splice site	probably benign
R0124:Casq1	UTSW	1	172210425	missense	probably damaging	1.00
R0485:Casq1	UTSW	1	172210390	unclassified	probably benign
R1982:Casq1	UTSW	1	172215530	missense	probably damaging	1.00
R2095:Casq1	UTSW	1	172215962	missense	probably benign	0.26
R2097:Casq1	UTSW	1	172210421	missense	probably damaging	1.00
R3940:Casq1	UTSW	1	172219536	missense	possibly damaging	0.91
R4654:Casq1	UTSW	1	172210398	unclassified	probably benign
R4790:Casq1	UTSW	1	172216837	missense	probably damaging	1.00
R5187:Casq1	UTSW	1	172213074	missense	possibly damaging	0.54
R5307:Casq1	UTSW	1	172219416	missense	probably damaging	1.00
R5973:Casq1	UTSW	1	172219501	missense	probably damaging	1.00
R6251:Casq1	UTSW	1	172216840	missense	probably benign	0.17
R6768:Casq1	UTSW	1	172219678	missense	probably benign	0.04
R7380:Casq1	UTSW	1	172216849	missense	probably benign	0.07
R9014:Casq1	UTSW	1	172210497	missense	probably damaging	1.00
R9292:Casq1	UTSW	1	172215547	missense	probably damaging	1.00
Z1176:Casq1	UTSW	1	172215914	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATAGCCATCTTGGAGGGAGC -3'
(R):5'- CCTAGAGCAGAAAGGATGCC -3'

Sequencing Primer
(F):5'- GGAAATGAGTCCAGACCTATTTCC -3'
(R):5'- GGATGCCATTAGAAAAGTCACC -3'

Posted On

2016-06-06