Mutagenetix > Incidental Mutation

Incidental Mutation 'R5002:Cenpe'

389983

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, Kif10, N-7 kinesin, CENP-E

MMRRC Submission

042596-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5002 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

134918324-134979301 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 134952842 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1511 (M1511L)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893
AA Change: M1511L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: M1511L

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197369

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,852,623 (GRCm39)	P736S	probably damaging	Het
Apbb2	A	G	5: 66,470,668 (GRCm39)	I523T	possibly damaging	Het
Casq1	T	A	1: 172,040,945 (GRCm39)	D281V	possibly damaging	Het
Catsperb	T	C	12: 101,486,813 (GRCm39)	F447L	probably benign	Het
Cep128	T	C	12: 91,222,497 (GRCm39)		probably null	Het
Col6a6	T	C	9: 105,663,292 (GRCm39)	T82A	probably benign	Het
Dna2	A	G	10: 62,786,621 (GRCm39)	D123G	probably damaging	Het
Ergic2	A	G	6: 148,085,656 (GRCm39)	I281T	probably benign	Het
Fcgbp	T	A	7: 27,785,528 (GRCm39)		probably null	Het
Filip1l	T	C	16: 57,391,466 (GRCm39)	Y447H	probably benign	Het
Flnb	T	A	14: 7,945,882 (GRCm38)	M2429K	probably damaging	Het
Fn1	T	A	1: 71,668,887 (GRCm39)	Q686L	possibly damaging	Het
Gm10644	T	C	8: 84,660,216 (GRCm39)	D43G	possibly damaging	Het
Gm10717	A	G	9: 3,025,532 (GRCm39)	Y39C	probably benign	Het
Gpx6	A	G	13: 21,497,858 (GRCm39)	Y43C	probably damaging	Het
Hhat	A	T	1: 192,225,498 (GRCm39)	F494I	probably benign	Het
Itga9	C	A	9: 118,492,966 (GRCm39)	S287*	probably null	Het
Lrrk1	C	A	7: 65,982,111 (GRCm39)	G177W	probably damaging	Het
Ltbp4	GT	G	7: 27,027,110 (GRCm39)		probably null	Het
Ms4a14	T	C	19: 11,281,653 (GRCm39)	I302V	probably benign	Het
Nepn	A	C	10: 52,267,850 (GRCm39)	M39L	probably benign	Het
Nfil3	C	A	13: 53,122,712 (GRCm39)	R64L	probably damaging	Het
Ociad1	T	C	5: 73,467,659 (GRCm39)	V199A	possibly damaging	Het
Or2r3	C	A	6: 42,448,906 (GRCm39)	V69L	probably benign	Het
Or8k3b	C	A	2: 86,520,429 (GRCm39)	V297L	possibly damaging	Het
Polk	A	G	13: 96,625,752 (GRCm39)	Y431H	probably damaging	Het
Prss33	C	T	17: 24,054,332 (GRCm39)		probably benign	Het
Semp2l2b	G	C	10: 21,943,716 (GRCm39)	P88R	probably damaging	Het
Slc12a7	A	G	13: 73,911,896 (GRCm39)	N4S	possibly damaging	Het
Slc29a4	A	T	5: 142,704,501 (GRCm39)	I348F	probably damaging	Het
Smarce1	T	C	11: 99,115,889 (GRCm39)	N44S	probably damaging	Het
Spast	C	T	17: 74,676,221 (GRCm39)	Q344*	probably null	Het
Stk11ip	C	A	1: 75,509,187 (GRCm39)		probably benign	Het
Tas2r131	T	C	6: 132,934,114 (GRCm39)	I232V	probably benign	Het
Tesk1	T	C	4: 43,444,573 (GRCm39)	Y126H	probably damaging	Het
Tmpo	A	G	10: 90,999,976 (GRCm39)	V164A	possibly damaging	Het
Ttc23l	G	T	15: 10,551,636 (GRCm39)	T30K	possibly damaging	Het
Vwc2l	T	G	1: 70,768,205 (GRCm39)	C43G	probably damaging	Het
Wnk1	G	A	6: 119,914,924 (GRCm39)	T1626I	probably benign	Het
Zpld2	T	A	4: 133,924,231 (GRCm39)	N438I	probably benign	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	134,937,216 (GRCm39)	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	134,934,678 (GRCm39)	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	134,965,112 (GRCm39)	missense	probably benign
IGL01446:Cenpe	APN	3	134,943,300 (GRCm39)	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	134,934,567 (GRCm39)	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	134,924,268 (GRCm39)	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	134,961,238 (GRCm39)	missense	probably benign
IGL02337:Cenpe	APN	3	134,926,037 (GRCm39)	splice site	probably benign
IGL02382:Cenpe	APN	3	134,953,147 (GRCm39)	missense	probably benign
IGL02458:Cenpe	APN	3	134,935,869 (GRCm39)	nonsense	probably null
IGL02934:Cenpe	APN	3	134,970,112 (GRCm39)	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	134,949,386 (GRCm39)	missense	probably benign
R0086:Cenpe	UTSW	3	134,970,185 (GRCm39)	splice site	probably benign
R0173:Cenpe	UTSW	3	134,965,744 (GRCm39)	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	134,922,186 (GRCm39)	splice site	probably benign
R0411:Cenpe	UTSW	3	134,928,016 (GRCm39)	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	134,952,347 (GRCm39)	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	134,952,588 (GRCm39)	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	134,935,843 (GRCm39)	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	134,923,066 (GRCm39)	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	134,970,183 (GRCm39)	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	134,952,663 (GRCm39)	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	134,976,661 (GRCm39)	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	134,944,155 (GRCm39)	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	134,945,519 (GRCm39)	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	134,971,694 (GRCm39)	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	134,952,257 (GRCm39)	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	134,945,606 (GRCm39)	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	134,974,740 (GRCm39)	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	134,953,240 (GRCm39)	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	134,948,254 (GRCm39)	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	134,928,082 (GRCm39)	splice site	probably benign
R2118:Cenpe	UTSW	3	134,952,645 (GRCm39)	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	134,945,541 (GRCm39)	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	134,953,235 (GRCm39)	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	134,967,397 (GRCm39)	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	134,967,397 (GRCm39)	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	134,953,874 (GRCm39)	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	134,946,834 (GRCm39)	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	134,946,782 (GRCm39)	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	134,962,337 (GRCm39)	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	134,928,083 (GRCm39)	splice site	probably benign
R3974:Cenpe	UTSW	3	134,940,986 (GRCm39)	splice site	probably null
R3975:Cenpe	UTSW	3	134,944,233 (GRCm39)	critical splice donor site	probably null
R3975:Cenpe	UTSW	3	134,940,986 (GRCm39)	splice site	probably null
R4151:Cenpe	UTSW	3	134,920,914 (GRCm39)	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	134,949,479 (GRCm39)	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	134,952,761 (GRCm39)	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	134,949,469 (GRCm39)	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	134,922,140 (GRCm39)	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	134,953,912 (GRCm39)	missense	probably benign
R4976:Cenpe	UTSW	3	134,940,637 (GRCm39)	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	134,940,689 (GRCm39)	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	134,962,401 (GRCm39)	missense	probably damaging	1.00
R5057:Cenpe	UTSW	3	134,926,074 (GRCm39)	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	134,976,715 (GRCm39)	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	134,948,064 (GRCm39)	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	134,935,911 (GRCm39)	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	134,965,149 (GRCm39)	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	134,929,026 (GRCm39)	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	134,974,826 (GRCm39)	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	134,940,837 (GRCm39)	nonsense	probably null
R5608:Cenpe	UTSW	3	134,940,837 (GRCm39)	nonsense	probably null
R5627:Cenpe	UTSW	3	134,941,234 (GRCm39)	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	134,954,174 (GRCm39)	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	134,967,341 (GRCm39)	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	134,967,389 (GRCm39)	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	134,965,834 (GRCm39)	nonsense	probably null
R6163:Cenpe	UTSW	3	134,974,764 (GRCm39)	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	134,954,291 (GRCm39)	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	134,949,536 (GRCm39)	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	134,935,936 (GRCm39)	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	134,945,539 (GRCm39)	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	134,957,289 (GRCm39)	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	134,957,305 (GRCm39)	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	134,943,899 (GRCm39)	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	134,949,583 (GRCm39)	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	134,940,888 (GRCm39)	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	134,940,963 (GRCm39)	missense	probably benign	0.02
R7009:Cenpe	UTSW	3	134,940,962 (GRCm39)	missense	probably damaging	0.97
R7039:Cenpe	UTSW	3	134,961,217 (GRCm39)	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	134,952,798 (GRCm39)	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	134,947,916 (GRCm39)	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	134,949,523 (GRCm39)	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	134,954,395 (GRCm39)	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	134,953,220 (GRCm39)	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	134,948,063 (GRCm39)	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	134,953,096 (GRCm39)	splice site	probably null
R7771:Cenpe	UTSW	3	134,946,702 (GRCm39)	splice site	probably null
R7843:Cenpe	UTSW	3	134,938,720 (GRCm39)	nonsense	probably null
R7973:Cenpe	UTSW	3	134,929,011 (GRCm39)	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	134,945,609 (GRCm39)	frame shift	probably null
R8069:Cenpe	UTSW	3	134,949,479 (GRCm39)	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	134,952,783 (GRCm39)	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	134,935,851 (GRCm39)	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	134,957,375 (GRCm39)	missense	probably benign
R8251:Cenpe	UTSW	3	134,957,445 (GRCm39)	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	134,948,388 (GRCm39)	nonsense	probably null
R8488:Cenpe	UTSW	3	134,965,002 (GRCm39)	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	134,929,001 (GRCm39)	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	134,930,777 (GRCm39)	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	134,965,862 (GRCm39)	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	134,945,644 (GRCm39)	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	134,976,572 (GRCm39)	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	134,923,797 (GRCm39)	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	134,945,641 (GRCm39)	nonsense	probably null
R9221:Cenpe	UTSW	3	134,935,839 (GRCm39)	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	134,954,207 (GRCm39)	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	134,976,609 (GRCm39)	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	134,922,146 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACTAGAGCAACTCAGGGAGC -3'
(R):5'- GTTAGGTCTGAGGCACACAC -3'

Sequencing Primer
(F):5'- AACTCAGGGAGCTGCTGC -3'
(R):5'- TTAGGTCTGAGGCACACACAGAAG -3'

Posted On

2016-06-06