Mutagenetix > Incidental Mutation

Incidental Mutation 'R5002:Gm7534'

389984

Institutional Source

Beutler Lab

Gene Symbol

Gm7534

Ensembl Gene

ENSMUSG00000073747

Gene Name

predicted gene 7534

Synonyms

MMRRC Submission

042596-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R5002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134190804-134203004 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 134196920 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 438 (N438I)

Ref Sequence

ENSEMBL: ENSMUSP00000095461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097849]

AlphaFold

Q3UU21

Predicted Effect

probably benign
Transcript: ENSMUST00000097849
AA Change: N438I

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: N438I

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
internal_repeat_1	21	111	5.47e-40	PROSPERO
low complexity region	112	143	N/A	INTRINSIC
low complexity region	158	177	N/A	INTRINSIC
internal_repeat_1	181	271	5.47e-40	PROSPERO
low complexity region	322	334	N/A	INTRINSIC
ZP	368	618	3.21e-13	SMART
low complexity region	650	668	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122228

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

94% (44/47)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	C	10: 22,067,817	P88R	probably damaging	Het
Abca8b	G	A	11: 109,961,797	P736S	probably damaging	Het
Apbb2	A	G	5: 66,313,325	I523T	possibly damaging	Het
Casq1	T	A	1: 172,213,378	D281V	possibly damaging	Het
Catsperb	T	C	12: 101,520,554	F447L	probably benign	Het
Cenpe	A	T	3: 135,247,081	M1511L	probably benign	Het
Cep128	T	C	12: 91,255,723		probably null	Het
Col6a6	T	C	9: 105,786,093	T82A	probably benign	Het
Dna2	A	G	10: 62,950,842	D123G	probably damaging	Het
Ergic2	A	G	6: 148,184,158	I281T	probably benign	Het
Fcgbp	T	A	7: 28,086,103		probably null	Het
Filip1l	T	C	16: 57,571,103	Y447H	probably benign	Het
Flnb	T	A	14: 7,945,882	M2429K	probably damaging	Het
Fn1	T	A	1: 71,629,728	Q686L	possibly damaging	Het
Gm10644	T	C	8: 83,933,587	D43G	possibly damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gpx6	A	G	13: 21,313,688	Y43C	probably damaging	Het
Hhat	A	T	1: 192,543,190	F494I	probably benign	Het
Itga9	C	A	9: 118,663,898	S287*	probably null	Het
Lrrk1	C	A	7: 66,332,363	G177W	probably damaging	Het
Ltbp4	GT	G	7: 27,327,685		probably null	Het
Ms4a14	T	C	19: 11,304,289	I302V	probably benign	Het
Nepn	A	C	10: 52,391,754	M39L	probably benign	Het
Nfil3	C	A	13: 52,968,676	R64L	probably damaging	Het
Ociad1	T	C	5: 73,310,316	V199A	possibly damaging	Het
Olfr1087	C	A	2: 86,690,085	V297L	possibly damaging	Het
Olfr457	C	A	6: 42,471,972	V69L	probably benign	Het
Polk	A	G	13: 96,489,244	Y431H	probably damaging	Het
Prss33	C	T	17: 23,835,358		probably benign	Het
Slc12a7	A	G	13: 73,763,777	N4S	possibly damaging	Het
Slc29a4	A	T	5: 142,718,746	I348F	probably damaging	Het
Smarce1	T	C	11: 99,225,063	N44S	probably damaging	Het
Spast	C	T	17: 74,369,226	Q344*	probably null	Het
Stk11ip	C	A	1: 75,532,543		probably benign	Het
Tas2r131	T	C	6: 132,957,151	I232V	probably benign	Het
Tesk1	T	C	4: 43,444,573	Y126H	probably damaging	Het
Tmpo	A	G	10: 91,164,114	V164A	possibly damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vwc2l	T	G	1: 70,729,046	C43G	probably damaging	Het
Wnk1	G	A	6: 119,937,963	T1626I	probably benign	Het

Other mutations in Gm7534

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02183:Gm7534	APN	4	134201980	missense	probably benign	0.27
IGL03170:Gm7534	APN	4	134193034	missense	possibly damaging	0.57
FR4342:Gm7534	UTSW	4	134202631	small insertion	probably benign
FR4976:Gm7534	UTSW	4	134202630	small insertion	probably benign
R0487:Gm7534	UTSW	4	134202778	missense	probably damaging	0.97
R0530:Gm7534	UTSW	4	134202910	missense	probably benign
R0553:Gm7534	UTSW	4	134202518	missense	possibly damaging	0.85
R1121:Gm7534	UTSW	4	134202937	missense	probably benign	0.00
R1458:Gm7534	UTSW	4	134196833	missense	probably benign	0.01
R1748:Gm7534	UTSW	4	134200299	missense	probably damaging	1.00
R1748:Gm7534	UTSW	4	134202119	missense	possibly damaging	0.57
R1913:Gm7534	UTSW	4	134192675	critical splice donor site	probably null
R2029:Gm7534	UTSW	4	134202358	missense	possibly damaging	0.87
R2069:Gm7534	UTSW	4	134201941	missense	possibly damaging	0.63
R2237:Gm7534	UTSW	4	134202205	missense	unknown
R2239:Gm7534	UTSW	4	134202205	missense	unknown
R3943:Gm7534	UTSW	4	134200345	missense	probably benign	0.15
R4646:Gm7534	UTSW	4	134202148	missense	probably benign	0.00
R4673:Gm7534	UTSW	4	134200347	missense	probably benign	0.01
R4838:Gm7534	UTSW	4	134193099	missense	probably benign	0.04
R5593:Gm7534	UTSW	4	134193039	missense	probably damaging	0.99
R5606:Gm7534	UTSW	4	134200212	missense	probably benign	0.13
R6553:Gm7534	UTSW	4	134202056	missense	probably damaging	0.99
R6834:Gm7534	UTSW	4	134193165	missense	possibly damaging	0.95
R6931:Gm7534	UTSW	4	134193153	missense	probably benign	0.28
R7526:Gm7534	UTSW	4	134200073	splice site	probably null
R7771:Gm7534	UTSW	4	134195443	missense	probably benign	0.01
R8271:Gm7534	UTSW	4	134202967	missense	unknown
R8725:Gm7534	UTSW	4	134202839	missense	probably benign	0.19
R8727:Gm7534	UTSW	4	134202839	missense	probably benign	0.19
R8757:Gm7534	UTSW	4	134202971	missense	unknown
R8966:Gm7534	UTSW	4	134202401	missense	probably damaging	0.98
R8992:Gm7534	UTSW	4	134202667	missense	probably damaging	0.99
R9039:Gm7534	UTSW	4	134195547	missense	probably damaging	0.98
R9275:Gm7534	UTSW	4	134195459	missense	probably damaging	1.00
R9278:Gm7534	UTSW	4	134195459	missense	probably damaging	1.00
R9434:Gm7534	UTSW	4	134202242	missense	probably benign	0.01
R9458:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9460:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9461:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9480:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9481:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9551:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9552:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
R9553:Gm7534	UTSW	4	134202001	missense	probably benign	0.36
RF015:Gm7534	UTSW	4	134193027	missense	probably benign
T0975:Gm7534	UTSW	4	134202629	small insertion	probably benign
Z1176:Gm7534	UTSW	4	134200338	missense	possibly damaging	0.90
Z1176:Gm7534	UTSW	4	134202677	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATGAGAACTCAGGGTGGCC -3'
(R):5'- GCTCCGTTTTAAGAGAAGGAAC -3'

Sequencing Primer
(F):5'- CCAGGGCTTAGCTGCAG -3'
(R):5'- AACTTAGGACCCATGGCGTG -3'

Posted On

2016-06-06