Incidental Mutation 'R5002:Smarce1'
ID390003
Institutional Source Beutler Lab
Gene Symbol Smarce1
Ensembl Gene ENSMUSG00000037935
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
Synonyms2810417B20Rik, BAF57, 9030408N19Rik, 5830412H02Rik
MMRRC Submission 042596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5002 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99209047-99231017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99225063 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000099422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103133]
Predicted Effect probably damaging
Transcript: ENSMUST00000103133
AA Change: N44S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099422
Gene: ENSMUSG00000037935
AA Change: N44S

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
HMG 65 135 8.37e-15 SMART
low complexity region 149 163 N/A INTRINSIC
Blast:HMG 165 205 1e-20 BLAST
coiled coil region 222 319 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155062
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the large ATP-dependent chromatin remodeling complex SWI/SNF, which is required for transcriptional activation of genes normally repressed by chromatin. The encoded protein, either alone or when in the SWI/SNF complex, can bind to 4-way junction DNA, which is thought to mimic the topology of DNA as it enters or exits the nucleosome. The protein contains a DNA-binding HMG domain, but disruption of this domain does not abolish the DNA-binding or nucleosome-displacement activities of the SWI/SNF complex. Unlike most of the SWI/SNF complex proteins, this protein has no yeast counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G C 10: 22,067,817 P88R probably damaging Het
Abca8b G A 11: 109,961,797 P736S probably damaging Het
Apbb2 A G 5: 66,313,325 I523T possibly damaging Het
Casq1 T A 1: 172,213,378 D281V possibly damaging Het
Catsperb T C 12: 101,520,554 F447L probably benign Het
Cenpe A T 3: 135,247,081 M1511L probably benign Het
Cep128 T C 12: 91,255,723 probably null Het
Col6a6 T C 9: 105,786,093 T82A probably benign Het
Dna2 A G 10: 62,950,842 D123G probably damaging Het
Ergic2 A G 6: 148,184,158 I281T probably benign Het
Fcgbp T A 7: 28,086,103 probably null Het
Filip1l T C 16: 57,571,103 Y447H probably benign Het
Flnb T A 14: 7,945,882 M2429K probably damaging Het
Fn1 T A 1: 71,629,728 Q686L possibly damaging Het
Gm10644 T C 8: 83,933,587 D43G possibly damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm7534 T A 4: 134,196,920 N438I probably benign Het
Gpx6 A G 13: 21,313,688 Y43C probably damaging Het
Hhat A T 1: 192,543,190 F494I probably benign Het
Itga9 C A 9: 118,663,898 S287* probably null Het
Lrrk1 C A 7: 66,332,363 G177W probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Ms4a14 T C 19: 11,304,289 I302V probably benign Het
Nepn A C 10: 52,391,754 M39L probably benign Het
Nfil3 C A 13: 52,968,676 R64L probably damaging Het
Ociad1 T C 5: 73,310,316 V199A possibly damaging Het
Olfr1087 C A 2: 86,690,085 V297L possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Polk A G 13: 96,489,244 Y431H probably damaging Het
Prss33 C T 17: 23,835,358 probably benign Het
Slc12a7 A G 13: 73,763,777 N4S possibly damaging Het
Slc29a4 A T 5: 142,718,746 I348F probably damaging Het
Spast C T 17: 74,369,226 Q344* probably null Het
Stk11ip C A 1: 75,532,543 probably benign Het
Tas2r131 T C 6: 132,957,151 I232V probably benign Het
Tesk1 T C 4: 43,444,573 Y126H probably damaging Het
Tmpo A G 10: 91,164,114 V164A possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vwc2l T G 1: 70,729,046 C43G probably damaging Het
Wnk1 G A 6: 119,937,963 T1626I probably benign Het
Other mutations in Smarce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Smarce1 APN 11 99210187 missense possibly damaging 0.69
IGL01477:Smarce1 APN 11 99210187 missense possibly damaging 0.69
IGL02256:Smarce1 APN 11 99219380 missense possibly damaging 0.63
R0524:Smarce1 UTSW 11 99214062 missense probably damaging 1.00
R4721:Smarce1 UTSW 11 99220717 missense probably benign 0.01
R4953:Smarce1 UTSW 11 99215151 missense probably benign 0.45
R7605:Smarce1 UTSW 11 99228292 missense probably benign
R8007:Smarce1 UTSW 11 99225050 missense possibly damaging 0.95
Z1176:Smarce1 UTSW 11 99210095 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCCAGGTACATATCCAGACTGC -3'
(R):5'- TGCTTGTTTAAACTCAGGTTGC -3'

Sequencing Primer
(F):5'- AAAGGACCTAGCTCTGGAG -3'
(R):5'- CTTGTTTAAACTCAGGTTGCTTTTG -3'
Posted On2016-06-06