Incidental Mutation 'R5002:Cep128'
ID390005
Institutional Source Beutler Lab
Gene Symbol Cep128
Ensembl Gene ENSMUSG00000061533
Gene Namecentrosomal protein 128
Synonyms4930534B04Rik, 5430424K18Rik
MMRRC Submission 042596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5002 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location90998492-91384409 bp(-) (GRCm38)
Type of Mutationintron (4263 bp from exon)
DNA Base Change (assembly) T to C at 91255723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140674] [ENSMUST00000141429] [ENSMUST00000143415]
Predicted Effect probably null
Transcript: ENSMUST00000140674
SMART Domains Protein: ENSMUSP00000119394
Gene: ENSMUSG00000061533

DomainStartEndE-ValueType
low complexity region 112 119 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141429
AA Change: D742G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115679
Gene: ENSMUSG00000061533
AA Change: D742G

DomainStartEndE-ValueType
low complexity region 89 110 N/A INTRINSIC
coiled coil region 216 329 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
coiled coil region 377 822 N/A INTRINSIC
coiled coil region 876 960 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143415
AA Change: D289G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122627
Gene: ENSMUSG00000061533
AA Change: D289G

DomainStartEndE-ValueType
coiled coil region 2 369 N/A INTRINSIC
coiled coil region 423 507 N/A INTRINSIC
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G C 10: 22,067,817 P88R probably damaging Het
Abca8b G A 11: 109,961,797 P736S probably damaging Het
Apbb2 A G 5: 66,313,325 I523T possibly damaging Het
Casq1 T A 1: 172,213,378 D281V possibly damaging Het
Catsperb T C 12: 101,520,554 F447L probably benign Het
Cenpe A T 3: 135,247,081 M1511L probably benign Het
Col6a6 T C 9: 105,786,093 T82A probably benign Het
Dna2 A G 10: 62,950,842 D123G probably damaging Het
Ergic2 A G 6: 148,184,158 I281T probably benign Het
Fcgbp T A 7: 28,086,103 probably null Het
Filip1l T C 16: 57,571,103 Y447H probably benign Het
Flnb T A 14: 7,945,882 M2429K probably damaging Het
Fn1 T A 1: 71,629,728 Q686L possibly damaging Het
Gm10644 T C 8: 83,933,587 D43G possibly damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm7534 T A 4: 134,196,920 N438I probably benign Het
Gpx6 A G 13: 21,313,688 Y43C probably damaging Het
Hhat A T 1: 192,543,190 F494I probably benign Het
Itga9 C A 9: 118,663,898 S287* probably null Het
Lrrk1 C A 7: 66,332,363 G177W probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Ms4a14 T C 19: 11,304,289 I302V probably benign Het
Nepn A C 10: 52,391,754 M39L probably benign Het
Nfil3 C A 13: 52,968,676 R64L probably damaging Het
Ociad1 T C 5: 73,310,316 V199A possibly damaging Het
Olfr1087 C A 2: 86,690,085 V297L possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Polk A G 13: 96,489,244 Y431H probably damaging Het
Prss33 C T 17: 23,835,358 probably benign Het
Slc12a7 A G 13: 73,763,777 N4S possibly damaging Het
Slc29a4 A T 5: 142,718,746 I348F probably damaging Het
Smarce1 T C 11: 99,225,063 N44S probably damaging Het
Spast C T 17: 74,369,226 Q344* probably null Het
Stk11ip C A 1: 75,532,543 probably benign Het
Tas2r131 T C 6: 132,957,151 I232V probably benign Het
Tesk1 T C 4: 43,444,573 Y126H probably damaging Het
Tmpo A G 10: 91,164,114 V164A possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vwc2l T G 1: 70,729,046 C43G probably damaging Het
Wnk1 G A 6: 119,937,963 T1626I probably benign Het
Other mutations in Cep128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cep128 APN 12 91234191 missense probably benign 0.17
IGL00800:Cep128 APN 12 91255664 missense possibly damaging 0.83
IGL01738:Cep128 APN 12 91230842 missense probably damaging 1.00
IGL01844:Cep128 APN 12 91008854 missense probably benign 0.14
IGL01918:Cep128 APN 12 91234210 missense probably damaging 0.99
IGL02043:Cep128 APN 12 91266730 splice site probably benign
IGL02405:Cep128 APN 12 91266986 missense probably benign 0.04
IGL02616:Cep128 APN 12 91296258 missense probably benign 0.03
PIT4260001:Cep128 UTSW 12 91299034 missense probably benign 0.00
R0416:Cep128 UTSW 12 91230867 splice site probably benign
R0442:Cep128 UTSW 12 91266771 missense probably damaging 1.00
R0608:Cep128 UTSW 12 90999535 utr 3 prime probably benign
R1108:Cep128 UTSW 12 91339109 missense probably damaging 1.00
R1178:Cep128 UTSW 12 91260155 missense probably damaging 1.00
R1183:Cep128 UTSW 12 91325598 missense possibly damaging 0.84
R1394:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1395:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1498:Cep128 UTSW 12 91366417 missense probably benign
R1541:Cep128 UTSW 12 91348781 missense probably damaging 1.00
R1639:Cep128 UTSW 12 91366368 missense probably damaging 1.00
R1643:Cep128 UTSW 12 91325532 missense probably damaging 1.00
R1682:Cep128 UTSW 12 91230822 missense probably damaging 0.99
R1739:Cep128 UTSW 12 91022491 splice site probably null
R1758:Cep128 UTSW 12 91347578 missense probably benign 0.02
R1845:Cep128 UTSW 12 91289598 missense probably benign 0.01
R1987:Cep128 UTSW 12 91230829 missense probably benign 0.01
R2017:Cep128 UTSW 12 91366464 missense probably damaging 0.98
R2237:Cep128 UTSW 12 91347567 missense probably benign 0.01
R2239:Cep128 UTSW 12 91347567 missense probably benign 0.01
R3103:Cep128 UTSW 12 91019344 missense probably damaging 0.99
R4552:Cep128 UTSW 12 91294162 missense probably damaging 0.98
R4664:Cep128 UTSW 12 91296253 missense probably damaging 1.00
R4774:Cep128 UTSW 12 91234195 missense probably damaging 0.99
R4838:Cep128 UTSW 12 90999545 utr 3 prime probably benign
R4858:Cep128 UTSW 12 91260162 missense probably benign 0.04
R4924:Cep128 UTSW 12 91022400 splice site silent
R5282:Cep128 UTSW 12 91339119 missense probably damaging 1.00
R5386:Cep128 UTSW 12 90999571 missense probably benign 0.03
R5476:Cep128 UTSW 12 91213618 missense probably damaging 0.96
R5643:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5644:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5668:Cep128 UTSW 12 90999636 missense probably benign 0.01
R6057:Cep128 UTSW 12 91296224 missense possibly damaging 0.92
R6831:Cep128 UTSW 12 91266974 missense probably damaging 0.99
R6852:Cep128 UTSW 12 91366342 critical splice donor site probably null
R7078:Cep128 UTSW 12 91234104 missense probably damaging 0.99
R7144:Cep128 UTSW 12 91294159 missense probably damaging 0.98
R7487:Cep128 UTSW 12 90999630 missense probably benign 0.05
R7582:Cep128 UTSW 12 91347566 missense probably damaging 0.96
R7713:Cep128 UTSW 12 91019322 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTACTATTTGTTAAGCAGCGTGC -3'
(R):5'- GTGCATGCAAAGAACGCTTG -3'

Sequencing Primer
(F):5'- TCCTCCTTAAGACTCTGGT -3'
(R):5'- GCAAAGAACGCTTGCTTTGC -3'
Posted On2016-06-06