Incidental Mutation 'R5004:Nup210l'
ID 390032
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 042597-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R5004 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 90087472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1082 (R1082*)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably null
Transcript: ENSMUST00000029548
AA Change: R1082*
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: R1082*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200410
AA Change: R1082*
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: R1082*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,605,927 (GRCm39) D189E possibly damaging Het
Abca5 C T 11: 110,170,202 (GRCm39) E1298K probably damaging Het
Actg1 C A 11: 120,238,986 (GRCm39) probably benign Het
Add2 A G 6: 86,073,728 (GRCm39) T206A probably benign Het
Alox12e A G 11: 70,212,330 (GRCm39) V116A probably benign Het
Ankrd27 T A 7: 35,307,800 (GRCm39) D346E probably damaging Het
Arfgap3 T A 15: 83,194,497 (GRCm39) S391C possibly damaging Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Cars2 C T 8: 11,568,956 (GRCm39) probably null Het
Cav3 A G 6: 112,436,885 (GRCm39) K38R probably damaging Het
Ccdc159 G A 9: 21,844,241 (GRCm39) R101H probably damaging Het
Cops7b A G 1: 86,515,132 (GRCm39) probably benign Het
Cyp4a12b C T 4: 115,295,310 (GRCm39) T472I probably benign Het
Cyp4a32 T C 4: 115,458,238 (GRCm39) S23P probably damaging Het
Cyp4f13 T G 17: 33,144,760 (GRCm39) I275L probably benign Het
Dlgap1 T A 17: 71,025,222 (GRCm39) probably null Het
Dnajc12 A T 10: 63,222,486 (GRCm39) I4L probably benign Het
Ephb2 T A 4: 136,387,010 (GRCm39) D739V possibly damaging Het
Fam169a A G 13: 97,234,100 (GRCm39) Y124C probably damaging Het
Fbln5 T A 12: 101,727,080 (GRCm39) N303I probably damaging Het
Fdxr T C 11: 115,160,399 (GRCm39) E352G probably benign Het
Fhad1 T G 4: 141,729,910 (GRCm39) probably null Het
Fhod1 C T 8: 106,063,577 (GRCm39) probably benign Het
Fndc7 G A 3: 108,790,789 (GRCm39) T79M probably damaging Het
Fry A G 5: 150,357,069 (GRCm39) Q1872R probably benign Het
Gbx1 T C 5: 24,709,837 (GRCm39) H336R probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gpr15lg A T 14: 36,824,622 (GRCm39) C60S probably damaging Het
Hacl1 C A 14: 31,340,996 (GRCm39) C346F probably benign Het
Hectd4 C A 5: 121,466,262 (GRCm39) probably null Het
Hectd4 C T 5: 121,467,628 (GRCm39) P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 (GRCm38) E289D probably benign Het
Itih4 T G 14: 30,614,629 (GRCm39) L497R probably damaging Het
Kcnh3 A T 15: 99,124,383 (GRCm39) K91* probably null Het
Kiz C G 2: 146,811,899 (GRCm39) D669E possibly damaging Het
Klhl30 T A 1: 91,287,046 (GRCm39) probably null Het
Kndc1 C A 7: 139,512,792 (GRCm39) C1514* probably null Het
Lipo2 A G 19: 33,699,076 (GRCm39) probably null Het
Macf1 T C 4: 123,279,268 (GRCm39) D5921G probably damaging Het
Mau2 A G 8: 70,478,537 (GRCm39) Y394H probably damaging Het
Mctp1 T A 13: 76,789,923 (GRCm39) S50R possibly damaging Het
Mllt10 T C 2: 18,175,079 (GRCm39) Y3H probably damaging Het
Mon1b T C 8: 114,365,859 (GRCm39) S396P probably damaging Het
Mrgpra4 A C 7: 47,631,535 (GRCm39) L22R probably benign Het
Msln T G 17: 25,973,193 (GRCm39) M1L possibly damaging Het
Myh15 T A 16: 48,952,411 (GRCm39) I827N probably damaging Het
Myh7 T C 14: 55,209,140 (GRCm39) D1866G probably damaging Het
Myo5b T G 18: 74,877,844 (GRCm39) probably null Het
Nlrc5 T G 8: 95,247,844 (GRCm39) probably benign Het
Or12k7 A G 2: 36,958,422 (GRCm39) Y35C probably damaging Het
Or4f4b G A 2: 111,314,005 (GRCm39) V105I possibly damaging Het
Or5p63 T A 7: 107,811,323 (GRCm39) K138* probably null Het
Or7e169 T C 9: 19,757,398 (GRCm39) I172M probably benign Het
Pi4ka A T 16: 17,195,033 (GRCm39) C122S probably damaging Het
Pkd2l1 G T 19: 44,138,016 (GRCm39) A690E probably benign Het
Pramel22 T C 4: 143,380,706 (GRCm39) Q439R probably benign Het
Prickle2 A T 6: 92,393,736 (GRCm39) D312E probably benign Het
Prrc2a T A 17: 35,368,974 (GRCm39) N2021Y probably benign Het
Prss3 T C 6: 41,350,836 (GRCm39) Y218C probably damaging Het
Psg20 T C 7: 18,414,837 (GRCm39) T350A probably damaging Het
Ptprg A T 14: 12,220,667 (GRCm38) I1235F probably damaging Het
Ptprk T A 10: 28,462,059 (GRCm39) D1181E possibly damaging Het
Rcc2 T A 4: 140,444,977 (GRCm39) S415T possibly damaging Het
Ripor1 CAA CA 8: 106,345,452 (GRCm39) probably null Het
Rnf31 T C 14: 55,829,639 (GRCm39) L68P probably damaging Het
Rsph6a A T 7: 18,791,665 (GRCm39) E278V possibly damaging Het
Rubcnl C T 14: 75,269,617 (GRCm39) Q92* probably null Het
Scfd1 A G 12: 51,491,777 (GRCm39) R580G probably benign Het
Sec31a A T 5: 100,516,192 (GRCm39) N967K probably damaging Het
Sema4b C A 7: 79,866,093 (GRCm39) T154N probably benign Het
Septin14 T A 5: 129,770,040 (GRCm39) I219F possibly damaging Het
Serpinb9c A T 13: 33,334,338 (GRCm39) S235T probably benign Het
Setd4 G T 16: 93,388,133 (GRCm39) H118N probably benign Het
Siglec1 C T 2: 130,911,789 (GRCm39) V1697M probably benign Het
Siglec1 A T 2: 130,915,331 (GRCm39) L1420Q possibly damaging Het
Soat2 T A 15: 102,069,546 (GRCm39) H402Q probably damaging Het
Sp3 A T 2: 72,768,633 (GRCm39) V666D probably benign Het
Spef2 T G 15: 9,578,413 (GRCm39) S1704R probably benign Het
Spidr A T 16: 15,936,806 (GRCm39) W100R possibly damaging Het
Steap1 G T 5: 5,792,829 (GRCm39) Y27* probably null Het
Svep1 G T 4: 58,087,751 (GRCm39) T1776K probably benign Het
Tdpoz1 T A 3: 93,578,440 (GRCm39) T115S probably benign Het
Tet2 A T 3: 133,193,140 (GRCm39) H431Q possibly damaging Het
Tnrc6c T G 11: 117,611,872 (GRCm39) V170G probably benign Het
Tom1 T C 8: 75,778,630 (GRCm39) L99P probably damaging Het
Trim11 C A 11: 58,872,164 (GRCm39) probably benign Het
Trio T C 15: 27,755,264 (GRCm39) K955R probably damaging Het
Tubd1 C T 11: 86,452,146 (GRCm39) T371I probably damaging Het
Usp17lb C T 7: 104,490,884 (GRCm39) M13I probably benign Het
Usp29 A G 7: 6,965,158 (GRCm39) M334V probably benign Het
Usp34 A G 11: 23,414,586 (GRCm39) Y2843C probably damaging Het
Utp20 A T 10: 88,584,135 (GRCm39) I2674N probably damaging Het
Vmn2r14 T G 5: 109,368,246 (GRCm39) T249P probably benign Het
Vmn2r43 A T 7: 8,247,848 (GRCm39) F772I probably damaging Het
Vmn2r51 T A 7: 9,821,932 (GRCm39) E584D probably benign Het
Zbtb22 G T 17: 34,136,217 (GRCm39) A121S probably benign Het
Zfp273 A T 13: 67,973,673 (GRCm39) H267L probably damaging Het
Zkscan2 C T 7: 123,089,267 (GRCm39) V335M probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCTTAAACACCATTGAAAGGG -3'
(R):5'- CTGTATAACAAGGTCCTGTCTCC -3'

Sequencing Primer
(F):5'- ACACCATTGAAAGGGTTTGCTG -3'
(R):5'- GAACACTGACTGCTCTTCTGAAGG -3'
Posted On 2016-06-06