Incidental Mutation 'R5004:Hectd4'
ID390051
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121329565 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2526 (P2526S)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: P2526S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: P2526S

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100769
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCTCTCATCGCATAATTGC -3'
(R):5'- AGCTCAGAAGATGCAAGCC -3'

Sequencing Primer
(F):5'- TGCATATTAGAAGGTCACCTGATAG -3'
(R):5'- GGAAGCACACTCACCCTGG -3'
Posted On2016-06-06