Mutagenetix > Incidental Mutation

Incidental Mutation 'R5004:Usp34'

390083

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

042597-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R5004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23464586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 2843 (Y2843C)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129521

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: Y2862C

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: Y2862C

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148927

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: Y2843C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: Y2843C

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	A	C	8: 13,555,927	D189E	possibly damaging	Het
2610528A11Rik	A	T	14: 37,102,665	C60S	probably damaging	Het
Abca5	C	T	11: 110,279,376	E1298K	probably damaging	Het
Actg1	C	A	11: 120,348,160		probably benign	Het
Add2	A	G	6: 86,096,746	T206A	probably benign	Het
Alox12e	A	G	11: 70,321,504	V116A	probably benign	Het
Ankrd27	T	A	7: 35,608,375	D346E	probably damaging	Het
Arfgap3	T	A	15: 83,310,296	S391C	possibly damaging	Het
Bcor	C	T	X: 12,040,486	R1551Q	probably damaging	Het
Cars2	C	T	8: 11,518,956		probably null	Het
Cav3	A	G	6: 112,459,924	K38R	probably damaging	Het
Ccdc159	G	A	9: 21,932,945	R101H	probably damaging	Het
Cops7b	A	G	1: 86,587,410		probably benign	Het
Cyp4a12b	C	T	4: 115,438,113	T472I	probably benign	Het
Cyp4a32	T	C	4: 115,601,041	S23P	probably damaging	Het
Cyp4f13	T	G	17: 32,925,786	I275L	probably benign	Het
Dlgap1	T	A	17: 70,718,227		probably null	Het
Dnajc12	A	T	10: 63,386,707	I4L	probably benign	Het
Ephb2	T	A	4: 136,659,699	D739V	possibly damaging	Het
Fam169a	A	G	13: 97,097,592	Y124C	probably damaging	Het
Fbln5	T	A	12: 101,760,821	N303I	probably damaging	Het
Fdxr	T	C	11: 115,269,573	E352G	probably benign	Het
Fhad1	T	G	4: 142,002,599		probably null	Het
Fhod1	C	T	8: 105,336,945		probably benign	Het
Fndc7	G	A	3: 108,883,473	T79M	probably damaging	Het
Fry	A	G	5: 150,433,604	Q1872R	probably benign	Het
Gbx1	T	C	5: 24,504,839	H336R	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm13088	T	C	4: 143,654,136	Q439R	probably benign	Het
Hacl1	C	A	14: 31,619,039	C346F	probably benign	Het
Hectd4	C	A	5: 121,328,199		probably null	Het
Hectd4	C	T	5: 121,329,565	P2526S	possibly damaging	Het
Il3ra	A	T	14: 14,355,381	E289D	probably benign	Het
Itih4	T	G	14: 30,892,672	L497R	probably damaging	Het
Kcnh3	A	T	15: 99,226,502	K91*	probably null	Het
Kiz	C	G	2: 146,969,979	D669E	possibly damaging	Het
Klhl30	T	A	1: 91,359,324		probably null	Het
Kndc1	C	A	7: 139,932,879	C1514*	probably null	Het
Lipo2	A	G	19: 33,721,676		probably null	Het
Macf1	T	C	4: 123,385,475	D5921G	probably damaging	Het
Mau2	A	G	8: 70,025,887	Y394H	probably damaging	Het
Mctp1	T	A	13: 76,641,804	S50R	possibly damaging	Het
Mllt10	T	C	2: 18,170,268	Y3H	probably damaging	Het
Mon1b	T	C	8: 113,639,227	S396P	probably damaging	Het
Mrgpra4	A	C	7: 47,981,787	L22R	probably benign	Het
Msln	T	G	17: 25,754,219	M1L	possibly damaging	Het
Myh15	T	A	16: 49,132,048	I827N	probably damaging	Het
Myh7	T	C	14: 54,971,683	D1866G	probably damaging	Het
Myo5b	T	G	18: 74,744,773		probably null	Het
Nlrc5	T	G	8: 94,521,216		probably benign	Het
Nup210l	A	T	3: 90,180,165	R1082*	probably null	Het
Olfr1289	G	A	2: 111,483,660	V105I	possibly damaging	Het
Olfr360	A	G	2: 37,068,410	Y35C	probably damaging	Het
Olfr487	T	A	7: 108,212,116	K138*	probably null	Het
Olfr860	T	C	9: 19,846,102	I172M	probably benign	Het
Pi4ka	A	T	16: 17,377,169	C122S	probably damaging	Het
Pkd2l1	G	T	19: 44,149,577	A690E	probably benign	Het
Prickle2	A	T	6: 92,416,755	D312E	probably benign	Het
Prrc2a	T	A	17: 35,149,998	N2021Y	probably benign	Het
Prss3	T	C	6: 41,373,902	Y218C	probably damaging	Het
Psg20	T	C	7: 18,680,912	T350A	probably damaging	Het
Ptprg	A	T	14: 12,220,667	I1235F	probably damaging	Het
Ptprk	T	A	10: 28,586,063	D1181E	possibly damaging	Het
Rcc2	T	A	4: 140,717,666	S415T	possibly damaging	Het
Ripor1	CAA	CA	8: 105,618,820		probably null	Het
Rnf31	T	C	14: 55,592,182	L68P	probably damaging	Het
Rsph6a	A	T	7: 19,057,740	E278V	possibly damaging	Het
Rubcnl	C	T	14: 75,032,177	Q92*	probably null	Het
Scfd1	A	G	12: 51,444,994	R580G	probably benign	Het
Sec31a	A	T	5: 100,368,333	N967K	probably damaging	Het
Sema4b	C	A	7: 80,216,345	T154N	probably benign	Het
Sept14	T	A	5: 129,692,976	I219F	possibly damaging	Het
Serpinb9c	A	T	13: 33,150,355	S235T	probably benign	Het
Setd4	G	T	16: 93,591,245	H118N	probably benign	Het
Siglec1	C	T	2: 131,069,869	V1697M	probably benign	Het
Siglec1	A	T	2: 131,073,411	L1420Q	possibly damaging	Het
Soat2	T	A	15: 102,161,111	H402Q	probably damaging	Het
Sp3	A	T	2: 72,938,289	V666D	probably benign	Het
Spef2	T	G	15: 9,578,327	S1704R	probably benign	Het
Spidr	A	T	16: 16,118,942	W100R	possibly damaging	Het
Steap1	G	T	5: 5,742,829	Y27*	probably null	Het
Svep1	G	T	4: 58,087,751	T1776K	probably benign	Het
Tdpoz1	T	A	3: 93,671,133	T115S	probably benign	Het
Tet2	A	T	3: 133,487,379	H431Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,721,046	V170G	probably benign	Het
Tom1	T	C	8: 75,052,002	L99P	probably damaging	Het
Trim11	C	A	11: 58,981,338		probably benign	Het
Trio	T	C	15: 27,755,178	K955R	probably damaging	Het
Tubd1	C	T	11: 86,561,320	T371I	probably damaging	Het
Usp17lb	C	T	7: 104,841,677	M13I	probably benign	Het
Usp29	A	G	7: 6,962,159	M334V	probably benign	Het
Utp20	A	T	10: 88,748,273	I2674N	probably damaging	Het
Vmn2r14	T	G	5: 109,220,380	T249P	probably benign	Het
Vmn2r43	A	T	7: 8,244,849	F772I	probably damaging	Het
Vmn2r51	T	A	7: 10,088,005	E584D	probably benign	Het
Zbtb22	G	T	17: 33,917,243	A121S	probably benign	Het
Zfp273	A	T	13: 67,825,554	H267L	probably damaging	Het
Zkscan2	C	T	7: 123,490,044	V335M	probably damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTGCTGTTCATGGCAC -3'
(R):5'- TCTGATGAGAAGCTAGCTGTCG -3'

Sequencing Primer
(F):5'- GCTGCTGTTCATGGCACTACAAAG -3'
(R):5'- CGAGTAAATGCAGGTGATTGCTC -3'

Posted On

2016-06-06