Incidental Mutation 'R5004:Alox12e'
ID 390084
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5004 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70321504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 116 (V116A)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect probably benign
Transcript: ENSMUST00000019051
AA Change: V116A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: V116A

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149060
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R3739:Alox12e UTSW 11 70319842 missense probably damaging 1.00
R4463:Alox12e UTSW 11 70318256 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R5915:Alox12e UTSW 11 70318224 missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9027:Alox12e UTSW 11 70321774 missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
R9641:Alox12e UTSW 11 70321435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTACTCCCTGCTATAGGC -3'
(R):5'- ACTATCTGCCTAACCGAGGG -3'

Sequencing Primer
(F):5'- GGATTAATCCCTCCTTCCAGG -3'
(R):5'- TAACCGAGGGCACTGGTG -3'
Posted On 2016-06-06