Incidental Mutation 'R5004:Myh7'
ID390102
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R5004 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54971683 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1866 (D1866G)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000111456] [ENSMUST00000168485]
Predicted Effect probably damaging
Transcript: ENSMUST00000102803
AA Change: D1866G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: D1866G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104735
Predicted Effect probably benign
Transcript: ENSMUST00000111456
SMART Domains Protein: ENSMUSP00000107083
Gene: ENSMUSG00000040752

DomainStartEndE-ValueType
Pfam:Myosin_N 34 63 9.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168485
AA Change: D1866G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: D1866G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181782
SMART Domains Protein: ENSMUSP00000137786
Gene: ENSMUSG00000097652

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 44 94 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227401
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
R7709:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7710:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7711:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7712:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7817:Myh7 UTSW 14 54988801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGTTGACCTGGGACTC -3'
(R):5'- TTCTGTGAGGACCAGAGAGCATG -3'

Sequencing Primer
(F):5'- ACCTTGCGGAACTTGGACAG -3'
(R):5'- CCAGAGAGCATGCATTGGTTC -3'
Posted On2016-06-06