Incidental Mutation 'R5004:Trio'
ID390106
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5004 (G1)
Quality Score113
Status Not validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27755178 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 955 (K955R)
Ref Sequence ENSEMBL: ENSMUSP00000154309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]
Predicted Effect probably damaging
Transcript: ENSMUST00000090247
AA Change: K2099R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: K2099R

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226644
AA Change: K955R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGAACCAGAAATAGCAAGC -3'
(R):5'- TCCACTCAGGAAGGTTCAACC -3'

Sequencing Primer
(F):5'- AAGCAGCTCTGCAAGAAG -3'
(R):5'- CTCAGGAAGGTTCAACCCGAATG -3'
Posted On2016-06-06