Mutagenetix > Incidental Mutation

Incidental Mutation 'R0436:Cog2'

39011

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

038637-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0436 (G1)

Quality Score

150

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 124548514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	C	4: 62,543,445		probably benign	Het
Abcb10	C	T	8: 123,971,001	G195S	probably benign	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Alx4	A	T	2: 93,668,357	K145*	probably null	Het
Arl8a	G	A	1: 135,146,980	M1I	probably null	Het
B230118H07Rik	T	C	2: 101,610,519		probably benign	Het
Btbd16	G	A	7: 130,786,053	S134N	probably benign	Het
Ccdc136	T	A	6: 29,414,934	L474Q	probably damaging	Het
Cebpz	A	G	17: 78,935,650	Y192H	probably benign	Het
Cep95	A	G	11: 106,818,685	Q109R	probably null	Het
Cfap54	G	T	10: 93,038,975	Q520K	possibly damaging	Het
Cul1	A	G	6: 47,523,773	N702S	probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Dmxl2	T	C	9: 54,383,750	D2472G	probably damaging	Het
Ect2	A	G	3: 27,150,095	F22L	probably benign	Het
Ehd4	A	T	2: 120,102,341	D201E	probably damaging	Het
Eif4ebp3	A	G	18: 36,664,301		probably null	Het
Exd2	T	C	12: 80,490,770		probably benign	Het
Gtf2a1	A	C	12: 91,568,273		probably null	Het
H2-DMb1	A	G	17: 34,159,656	Y256C	probably damaging	Het
Haus6	T	C	4: 86,585,807	R527G	probably benign	Het
Helb	C	T	10: 120,094,212		probably benign	Het
Hhatl	C	T	9: 121,788,762	A254T	probably benign	Het
Hk1	A	T	10: 62,299,275		probably benign	Het
Hmcn2	A	G	2: 31,405,612	K2611R	probably damaging	Het
Hrc	A	G	7: 45,336,133	H236R	possibly damaging	Het
Hunk	T	A	16: 90,464,154	Y178N	probably damaging	Het
Jakmip2	G	A	18: 43,558,169	Q616*	probably null	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Msantd4	C	T	9: 4,385,180	R302C	probably damaging	Het
Nae1	T	C	8: 104,523,236		probably benign	Het
Nek4	C	T	14: 30,970,472	L293F	probably damaging	Het
Odf2l	C	T	3: 145,126,116	T44I	possibly damaging	Het
Olfr601	A	G	7: 103,358,741	V151A	possibly damaging	Het
Otog	G	A	7: 46,265,936		probably benign	Het
Ppp1r21	C	T	17: 88,565,689	T425I	possibly damaging	Het
Prrc2b	A	G	2: 32,230,660	E2204G	probably damaging	Het
Prrc2c	A	C	1: 162,705,314		probably benign	Het
Prrxl1	T	C	14: 32,608,083	F81S	probably damaging	Het
Ptgs2	T	C	1: 150,104,277		probably benign	Het
Slc12a8	T	A	16: 33,551,085	V197E	probably damaging	Het
Syne3	A	G	12: 104,946,924	W593R	possibly damaging	Het
Tmem63a	A	T	1: 180,972,733	T696S	probably benign	Het
Tnks2	A	G	19: 36,849,358	D165G	possibly damaging	Het
Trim43a	T	C	9: 88,588,187	W349R	probably damaging	Het
Unc45b	T	C	11: 82,929,567		probably benign	Het
Vmn1r4	T	A	6: 56,956,962	N150K	probably damaging	Het
Wdfy4	C	A	14: 33,083,812		probably benign	Het
Wdr77	T	A	3: 105,960,026	D63E	probably damaging	Het
Zan	T	C	5: 137,464,902	T672A	unknown	Het
Zdhhc17	A	T	10: 110,981,990		probably null	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCGTGCCATCCTGCTCCTTAAATAG -3'
(R):5'- GCAGTTTCTACAGGCAACCCAACG -3'

Sequencing Primer
(F):5'- GCTCCTTAAATAGGATCTGCCTAGTG -3'
(R):5'- TTGCCCAGGGTGCAGAC -3'

Posted On

2013-05-23