Incidental Mutation 'R0436:Cog2'
ID 39011
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Name component of oligomeric golgi complex 2
Synonyms Cog2, 1190002B08Rik, 2700012E02Rik
MMRRC Submission 038637-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0436 (G1)
Quality Score 150
Status Validated
Chromosome 8
Chromosomal Location 125247506-125278747 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 125275253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
AlphaFold Q921L5
Predicted Effect probably benign
Transcript: ENSMUST00000034460
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,461,682 (GRCm39) probably benign Het
Abcb10 C T 8: 124,697,740 (GRCm39) G195S probably benign Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Alx4 A T 2: 93,498,702 (GRCm39) K145* probably null Het
Arl8a G A 1: 135,074,718 (GRCm39) M1I probably null Het
Btbd16 G A 7: 130,387,783 (GRCm39) S134N probably benign Het
Ccdc136 T A 6: 29,414,933 (GRCm39) L474Q probably damaging Het
Cebpz A G 17: 79,243,079 (GRCm39) Y192H probably benign Het
Cep95 A G 11: 106,709,511 (GRCm39) Q109R probably null Het
Cfap54 G T 10: 92,874,837 (GRCm39) Q520K possibly damaging Het
Cul1 A G 6: 47,500,707 (GRCm39) N702S probably benign Het
D430041D05Rik G C 2: 103,998,295 (GRCm39) P1836R probably damaging Het
Dmxl2 T C 9: 54,291,034 (GRCm39) D2472G probably damaging Het
Drgx T C 14: 32,330,040 (GRCm39) F81S probably damaging Het
Ect2 A G 3: 27,204,244 (GRCm39) F22L probably benign Het
Ehd4 A T 2: 119,932,822 (GRCm39) D201E probably damaging Het
Eif4ebp3 A G 18: 36,797,354 (GRCm39) probably null Het
Exd2 T C 12: 80,537,544 (GRCm39) probably benign Het
Gtf2a1 A C 12: 91,535,047 (GRCm39) probably null Het
H2-DMb1 A G 17: 34,378,630 (GRCm39) Y256C probably damaging Het
Haus6 T C 4: 86,504,044 (GRCm39) R527G probably benign Het
Helb C T 10: 119,930,117 (GRCm39) probably benign Het
Hhatl C T 9: 121,617,828 (GRCm39) A254T probably benign Het
Hk1 A T 10: 62,135,054 (GRCm39) probably benign Het
Hmcn2 A G 2: 31,295,624 (GRCm39) K2611R probably damaging Het
Hrc A G 7: 44,985,557 (GRCm39) H236R possibly damaging Het
Hunk T A 16: 90,261,042 (GRCm39) Y178N probably damaging Het
Iftap T C 2: 101,440,864 (GRCm39) probably benign Het
Jakmip2 G A 18: 43,691,234 (GRCm39) Q616* probably null Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Msantd4 C T 9: 4,385,180 (GRCm39) R302C probably damaging Het
Nae1 T C 8: 105,249,868 (GRCm39) probably benign Het
Nek4 C T 14: 30,692,429 (GRCm39) L293F probably damaging Het
Odf2l C T 3: 144,831,877 (GRCm39) T44I possibly damaging Het
Or52s19 A G 7: 103,007,948 (GRCm39) V151A possibly damaging Het
Otog G A 7: 45,915,360 (GRCm39) probably benign Het
Ppp1r21 C T 17: 88,873,117 (GRCm39) T425I possibly damaging Het
Prrc2b A G 2: 32,120,672 (GRCm39) E2204G probably damaging Het
Prrc2c A C 1: 162,532,883 (GRCm39) probably benign Het
Ptgs2 T C 1: 149,980,028 (GRCm39) probably benign Het
Slc12a8 T A 16: 33,371,455 (GRCm39) V197E probably damaging Het
Syne3 A G 12: 104,913,183 (GRCm39) W593R possibly damaging Het
Tmem63a A T 1: 180,800,298 (GRCm39) T696S probably benign Het
Tnks2 A G 19: 36,826,758 (GRCm39) D165G possibly damaging Het
Trim43a T C 9: 88,470,240 (GRCm39) W349R probably damaging Het
Unc45b T C 11: 82,820,393 (GRCm39) probably benign Het
Vmn1r4 T A 6: 56,933,947 (GRCm39) N150K probably damaging Het
Wdfy4 C A 14: 32,805,769 (GRCm39) probably benign Het
Wdr77 T A 3: 105,867,342 (GRCm39) D63E probably damaging Het
Zan T C 5: 137,463,164 (GRCm39) T672A unknown Het
Zdhhc17 A T 10: 110,817,851 (GRCm39) probably null Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 125,271,982 (GRCm39) missense probably benign 0.00
IGL01092:Cog2 APN 8 125,272,019 (GRCm39) missense probably damaging 1.00
IGL01150:Cog2 APN 8 125,269,630 (GRCm39) missense possibly damaging 0.62
IGL02052:Cog2 APN 8 125,269,627 (GRCm39) critical splice acceptor site probably null
IGL02308:Cog2 APN 8 125,259,951 (GRCm39) critical splice acceptor site probably null
IGL02543:Cog2 APN 8 125,256,698 (GRCm39) missense probably benign 0.09
IGL02978:Cog2 APN 8 125,277,075 (GRCm39) missense probably benign
IGL03008:Cog2 APN 8 125,262,131 (GRCm39) splice site probably benign
IGL03144:Cog2 APN 8 125,267,763 (GRCm39) missense probably damaging 0.98
kugge UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
Pelota UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 125,272,010 (GRCm39) missense probably benign 0.22
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0110:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R0450:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R1365:Cog2 UTSW 8 125,267,713 (GRCm39) missense probably damaging 0.97
R1661:Cog2 UTSW 8 125,269,629 (GRCm39) missense probably benign 0.20
R1698:Cog2 UTSW 8 125,252,422 (GRCm39) missense probably damaging 1.00
R1856:Cog2 UTSW 8 125,278,142 (GRCm39) missense possibly damaging 0.93
R2122:Cog2 UTSW 8 125,255,724 (GRCm39) missense possibly damaging 0.91
R2398:Cog2 UTSW 8 125,256,665 (GRCm39) missense probably benign 0.07
R3855:Cog2 UTSW 8 125,256,742 (GRCm39) critical splice donor site probably null
R4580:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.01
R4803:Cog2 UTSW 8 125,262,190 (GRCm39) missense probably damaging 0.96
R5316:Cog2 UTSW 8 125,255,779 (GRCm39) missense probably benign 0.14
R5346:Cog2 UTSW 8 125,273,370 (GRCm39) missense possibly damaging 0.94
R5394:Cog2 UTSW 8 125,259,268 (GRCm39) missense probably benign 0.00
R5395:Cog2 UTSW 8 125,271,960 (GRCm39) missense probably benign 0.00
R5738:Cog2 UTSW 8 125,272,777 (GRCm39) missense probably benign 0.03
R5861:Cog2 UTSW 8 125,264,617 (GRCm39) missense probably damaging 1.00
R5894:Cog2 UTSW 8 125,272,006 (GRCm39) missense probably benign 0.00
R5941:Cog2 UTSW 8 125,272,825 (GRCm39) missense probably benign
R6186:Cog2 UTSW 8 125,273,425 (GRCm39) missense probably damaging 1.00
R6400:Cog2 UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
R6518:Cog2 UTSW 8 125,253,842 (GRCm39) nonsense probably null
R6558:Cog2 UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
R6717:Cog2 UTSW 8 125,252,488 (GRCm39) missense probably damaging 1.00
R6902:Cog2 UTSW 8 125,273,430 (GRCm39) missense probably damaging 1.00
R6914:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R6942:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R7103:Cog2 UTSW 8 125,267,853 (GRCm39) critical splice donor site probably null
R7274:Cog2 UTSW 8 125,262,258 (GRCm39) missense possibly damaging 0.71
R7641:Cog2 UTSW 8 125,264,621 (GRCm39) missense probably damaging 0.96
R7674:Cog2 UTSW 8 125,264,621 (GRCm39) missense probably damaging 0.96
R8559:Cog2 UTSW 8 125,269,647 (GRCm39) missense probably benign 0.25
R9190:Cog2 UTSW 8 125,260,058 (GRCm39) missense probably damaging 1.00
R9307:Cog2 UTSW 8 125,253,837 (GRCm39) critical splice acceptor site probably null
R9629:Cog2 UTSW 8 125,260,125 (GRCm39) missense possibly damaging 0.67
X0026:Cog2 UTSW 8 125,272,759 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCGTGCCATCCTGCTCCTTAAATAG -3'
(R):5'- GCAGTTTCTACAGGCAACCCAACG -3'

Sequencing Primer
(F):5'- GCTCCTTAAATAGGATCTGCCTAGTG -3'
(R):5'- TTGCCCAGGGTGCAGAC -3'
Posted On 2013-05-23