Incidental Mutation 'R0436:Cog2'
ID39011
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0436 (G1)
Quality Score150
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 124548514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCGTGCCATCCTGCTCCTTAAATAG -3'
(R):5'- GCAGTTTCTACAGGCAACCCAACG -3'

Sequencing Primer
(F):5'- GCTCCTTAAATAGGATCTGCCTAGTG -3'
(R):5'- TTGCCCAGGGTGCAGAC -3'
Posted On2013-05-23