Incidental Mutation 'R5005:Olfr1189'
ID390132
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5005 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88592004 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 67 (M67V)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably benign
Transcript: ENSMUST00000090700
AA Change: M67V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: M67V

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213679
AA Change: M67V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2b1 T C 11: 83,339,392 V412A probably damaging Het
Asic2 T C 11: 80,883,426 Y455C probably damaging Het
Bbx T C 16: 50,266,351 K61E probably damaging Het
Cd207 T C 6: 83,674,385 E196G possibly damaging Het
Chn1 T A 2: 73,659,786 Q49L possibly damaging Het
Cpd A G 11: 76,813,570 I406T probably damaging Het
D630003M21Rik C T 2: 158,211,643 V642I possibly damaging Het
Dnah7b C T 1: 46,242,028 L2750F probably damaging Het
Epyc A G 10: 97,674,700 T122A probably benign Het
Kcnt1 A G 2: 25,901,346 H567R probably damaging Het
Magi2 A G 5: 20,534,446 D729G probably damaging Het
Myh4 G T 11: 67,253,415 V1204L probably benign Het
Noa1 T C 5: 77,309,026 Y344C probably damaging Het
Olfr348 A G 2: 36,787,358 M278V probably benign Het
Pex1 T C 5: 3,622,310 S718P probably damaging Het
Plxnb1 T A 9: 109,106,579 V1061E probably benign Het
Rdh16f1 A G 10: 127,788,677 Q128R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc26a9 A T 1: 131,765,887 Q705L probably damaging Het
Tas2r143 T A 6: 42,400,724 C163S probably benign Het
Tigd2 A G 6: 59,211,146 T333A probably benign Het
Urb2 T C 8: 124,031,181 V1209A probably damaging Het
Vmn2r71 T A 7: 85,624,144 V722D probably damaging Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0565:Olfr1189 UTSW 2 88592009 missense probably benign 0.39
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1763:Olfr1189 UTSW 2 88592436 missense probably benign 0.02
R1847:Olfr1189 UTSW 2 88592172 missense probably damaging 1.00
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4410:Olfr1189 UTSW 2 88592421 missense probably benign 0.03
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5174:Olfr1189 UTSW 2 88592648 missense probably damaging 1.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
R7522:Olfr1189 UTSW 2 88592661 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCTGTGAAATCACTCATTCAAC -3'
(R):5'- GGCGACATAGCGATCATAGG -3'

Sequencing Primer
(F):5'- TGGATTCACCAGTTTTATGTTCTTC -3'
(R):5'- TAGCGATCATAGGCCATAACAATG -3'
Posted On2016-06-06