Incidental Mutation 'R5005:Tas2r143'
ID390137
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Nametaste receptor, type 2, member 143
Synonymsmt2r36, Tas2r43
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R5005 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42400238-42401119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42400724 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 163 (C163S)
Ref Sequence ENSEMBL: ENSMUSP00000057910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
AA Change: C163S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: C163S

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2b1 T C 11: 83,339,392 V412A probably damaging Het
Asic2 T C 11: 80,883,426 Y455C probably damaging Het
Bbx T C 16: 50,266,351 K61E probably damaging Het
Cd207 T C 6: 83,674,385 E196G possibly damaging Het
Chn1 T A 2: 73,659,786 Q49L possibly damaging Het
Cpd A G 11: 76,813,570 I406T probably damaging Het
D630003M21Rik C T 2: 158,211,643 V642I possibly damaging Het
Dnah7b C T 1: 46,242,028 L2750F probably damaging Het
Epyc A G 10: 97,674,700 T122A probably benign Het
Kcnt1 A G 2: 25,901,346 H567R probably damaging Het
Magi2 A G 5: 20,534,446 D729G probably damaging Het
Myh4 G T 11: 67,253,415 V1204L probably benign Het
Noa1 T C 5: 77,309,026 Y344C probably damaging Het
Olfr1189 A G 2: 88,592,004 M67V probably benign Het
Olfr348 A G 2: 36,787,358 M278V probably benign Het
Pex1 T C 5: 3,622,310 S718P probably damaging Het
Plxnb1 T A 9: 109,106,579 V1061E probably benign Het
Rdh16f1 A G 10: 127,788,677 Q128R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc26a9 A T 1: 131,765,887 Q705L probably damaging Het
Tigd2 A G 6: 59,211,146 T333A probably benign Het
Urb2 T C 8: 124,031,181 V1209A probably damaging Het
Vmn2r71 T A 7: 85,624,144 V722D probably damaging Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42400334 nonsense probably null
IGL02832:Tas2r143 APN 6 42400325 missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42400955 missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42400265 missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42400760 missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42400383 missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42400371 missense probably damaging 1.00
R2391:Tas2r143 UTSW 6 42400876 missense probably damaging 0.99
R3617:Tas2r143 UTSW 6 42401063 missense probably benign 0.20
R3693:Tas2r143 UTSW 6 42400976 missense probably benign 0.00
R4283:Tas2r143 UTSW 6 42401073 unclassified probably null
R4486:Tas2r143 UTSW 6 42400694 missense probably benign 0.15
R6360:Tas2r143 UTSW 6 42400835 missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42400268 missense probably benign
R7827:Tas2r143 UTSW 6 42400722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATCTTCTACTGTGTGAAG -3'
(R):5'- GGGATTTCAGAGCCATGGTATG -3'

Sequencing Primer
(F):5'- GCCATCTTCTACTGTGTGAAGATCTC -3'
(R):5'- TGCCTGAGTATGGAGATCCC -3'
Posted On2016-06-06