Incidental Mutation 'R5006:Sema4a'
ID 390159
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms SemB, SemB, Semab
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R5006 (G1)
Quality Score 213
Status Not validated
Chromosome 3
Chromosomal Location 88343266-88368489 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88344091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 720 (M720T)
Ref Sequence ENSEMBL: ENSMUSP00000128887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222]
AlphaFold Q62178
Predicted Effect probably benign
Transcript: ENSMUST00000029700
AA Change: M720T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: M720T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
AA Change: M588T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: M588T

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156108
Predicted Effect probably benign
Transcript: ENSMUST00000165898
AA Change: M720T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: M720T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
AA Change: M720T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: M720T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
AA Change: M720T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: M720T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183768
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,781,535 (GRCm39) E51* probably null Het
Bcl11a T A 11: 24,114,989 (GRCm39) Y777* probably null Het
C2cd4c T A 10: 79,448,341 (GRCm39) T269S probably benign Het
Ciao2a G A 9: 66,043,634 (GRCm39) probably null Het
Efcab3 T A 11: 104,620,503 (GRCm39) probably null Het
Foxp1 A C 6: 99,139,819 (GRCm39) V54G probably damaging Het
Il2ra T G 2: 11,679,157 (GRCm39) L39R possibly damaging Het
Klk1b9 A T 7: 43,628,711 (GRCm39) K72* probably null Het
Lmo7 A G 14: 102,163,673 (GRCm39) probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Nebl T A 2: 17,393,582 (GRCm39) probably null Het
Or6b6 C T 7: 106,570,808 (GRCm39) V248I probably damaging Het
Or7e169 G T 9: 19,757,567 (GRCm39) A116E probably benign Het
Or7g30 A G 9: 19,352,545 (GRCm39) N112S probably benign Het
Ralgapa1 A T 12: 55,764,899 (GRCm39) C918S probably benign Het
Rasd2 G T 8: 75,945,234 (GRCm39) R21L probably damaging Het
Susd3 A G 13: 49,392,181 (GRCm39) probably benign Het
Vmn1r235 T C 17: 21,482,467 (GRCm39) M264T probably benign Het
Wls A G 3: 159,617,428 (GRCm39) I368V possibly damaging Het
Ypel4 A G 2: 84,567,182 (GRCm39) D5G probably benign Het
Zbtb38 C T 9: 96,567,704 (GRCm39) G1127S probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88,357,117 (GRCm39) missense probably damaging 1.00
IGL01722:Sema4a APN 3 88,345,491 (GRCm39) missense probably benign 0.14
IGL01769:Sema4a APN 3 88,357,063 (GRCm39) missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88,357,829 (GRCm39) missense probably damaging 0.99
IGL02202:Sema4a APN 3 88,357,050 (GRCm39) missense probably damaging 1.00
R0145:Sema4a UTSW 3 88,358,729 (GRCm39) missense probably damaging 1.00
R0386:Sema4a UTSW 3 88,344,107 (GRCm39) missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88,360,405 (GRCm39) missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88,355,456 (GRCm39) unclassified probably benign
R1567:Sema4a UTSW 3 88,359,353 (GRCm39) missense probably damaging 1.00
R1675:Sema4a UTSW 3 88,362,073 (GRCm39) missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88,344,145 (GRCm39) missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88,344,056 (GRCm39) missense probably benign 0.04
R1961:Sema4a UTSW 3 88,345,483 (GRCm39) splice site probably benign
R2029:Sema4a UTSW 3 88,358,668 (GRCm39) missense probably damaging 1.00
R4934:Sema4a UTSW 3 88,345,568 (GRCm39) missense probably damaging 1.00
R5309:Sema4a UTSW 3 88,344,343 (GRCm39) missense probably damaging 1.00
R5312:Sema4a UTSW 3 88,344,343 (GRCm39) missense probably damaging 1.00
R5338:Sema4a UTSW 3 88,358,804 (GRCm39) missense probably benign 0.01
R5481:Sema4a UTSW 3 88,360,347 (GRCm39) nonsense probably null
R5510:Sema4a UTSW 3 88,357,293 (GRCm39) critical splice donor site probably null
R6046:Sema4a UTSW 3 88,348,008 (GRCm39) missense probably damaging 1.00
R7242:Sema4a UTSW 3 88,357,416 (GRCm39) missense probably damaging 1.00
R8403:Sema4a UTSW 3 88,359,341 (GRCm39) missense probably damaging 0.98
R8798:Sema4a UTSW 3 88,344,004 (GRCm39) missense possibly damaging 0.76
R9328:Sema4a UTSW 3 88,345,613 (GRCm39) nonsense probably null
R9638:Sema4a UTSW 3 88,357,066 (GRCm39) missense probably damaging 1.00
R9728:Sema4a UTSW 3 88,348,187 (GRCm39) critical splice acceptor site probably null
Z1176:Sema4a UTSW 3 88,344,500 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACACGTTAGCAGGAGAGC -3'
(R):5'- GTCTCCTATTGGGTAGACAGCC -3'

Sequencing Primer
(F):5'- TCCTACCCTGGTCAGAGTG -3'
(R):5'- GTAGACAGCCAGGACCAGC -3'
Posted On 2016-06-06